Rroxscaffold_4G00313230

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0000643
Physical Location & Seq
Forward (+)
36471382 .. 36476852
5471 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00313230.1

Sequence Viewer

Length: 213 bp
ATGATGATAAGGAAGATGGGAGCTGGTGTGAGAAGAAGCGCGTGTCATTGGTGGGGAAGCCACGTGGCATTGGGAGGGTCAAGGAGCGTTGGACCGGAGAGTAGGATGAAGAAGAGGTGGGAGATTCCTAGTGAGGTGGTGGTGTTCCAGGGTTTGGAGGAGTACGGTGTTGCTGAAATGGGTGATGTGCTGCCGAAGATTAGGACCGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.83

Weight (kDa)

9.85

Isoelectric Point (pI)

79.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 154
AccII CGCG 1 cut(s) 41
AcvI CACGTG 1 cut(s) 64
AfaI GTAC 1 cut(s) 164
AfiI CCNNNNNNNGG 1 cut(s) 154
AjnI CCWGG 1 cut(s) 147
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
ApeKI GCWGC 1 cut(s) 190
AspLEI GCGC 1 cut(s) 41
AspS9I GGNCC 2 cut(s) 92, 204
AsuHPI GGTGA 1 cut(s) 194
AvaII GGWCC 2 cut(s) 92, 204
BbrPI CACGTG 1 cut(s) 64
BbvI GCAGC 1 cut(s) 177
BccI CCATC 1 cut(s) 10
BciT130I CCWGG 1 cut(s) 149
BfaI CTAG 1 cut(s) 129
BisI GCNGC 1 cut(s) 191
BlsI GCNGC 1 cut(s) 192
Bme1390I CCNGG 1 cut(s) 149
Bme18I GGWCC 2 cut(s) 92, 204
BmgT120I GGNCC 2 cut(s) 92, 204
BmrFI CCNGG 1 cut(s) 149
BsaAI YACGTR 1 cut(s) 64
BsaJI CCNNGG 1 cut(s) 148
BsaWI WCCGGW 1 cut(s) 94
BsaXI ACNNNNNCTCC 2 cut(s) 12, 42
Bsc4I CCNNNNNNNGG 1 cut(s) 154
BseBI CCWGG 1 cut(s) 149
BseDI CCNNGG 1 cut(s) 148
BseGI GGATG 1 cut(s) 111
BseLI CCNNNNNNNGG 1 cut(s) 154
BseRI GAGGAG 1 cut(s) 173
BseXI GCAGC 1 cut(s) 177
Bsh1236I CGCG 1 cut(s) 41
BsiSI CCGG 1 cut(s) 95
BslI CCNNNNNNNGG 1 cut(s) 154
BspFNI CGCG 1 cut(s) 41
BssECI CCNNGG 1 cut(s) 148
Bst2UI CCWGG 1 cut(s) 149
Bst4CI ACNGT 2 cut(s) 167, 208
Bst6I CTCTTC 1 cut(s) 107
BstBAI YACGTR 1 cut(s) 64
BstF5I GGATG 1 cut(s) 111
BstFNI CGCG 1 cut(s) 41
BstHHI GCGC 1 cut(s) 41
BstNI CCWGG 1 cut(s) 149
BstSCI CCNGG 1 cut(s) 147
BstUI CGCG 1 cut(s) 41
BstV1I GCAGC 1 cut(s) 177
BtsCI GGATG 1 cut(s) 111
CfoI GCGC 1 cut(s) 41
Cfr13I GGNCC 2 cut(s) 92, 204
Csp6I GTAC 1 cut(s) 163
CviJI RGCY 2 cut(s) 23, 60
CviKI_1 RGCY 2 cut(s) 23, 60
CviQI GTAC 1 cut(s) 163
Eam1104I CTCTTC 1 cut(s) 107
EarI CTCTTC 1 cut(s) 107
Eco47I GGWCC 2 cut(s) 92, 204
Eco72I CACGTG 1 cut(s) 64
EcoRII CCWGG 1 cut(s) 147
Fnu4HI GCNGC 1 cut(s) 191
FokI GGATG 1 cut(s) 118
Fsp4HI GCNGC 1 cut(s) 191
FspBI CTAG 1 cut(s) 129
GlaI GCGC 1 cut(s) 40
GluI GCNGC 1 cut(s) 191
HapII CCGG 1 cut(s) 95
HhaI GCGC 1 cut(s) 41
Hin6I GCGC 1 cut(s) 39
HinP1I GCGC 1 cut(s) 39
HinfI GANTC 1 cut(s) 124
HpaII CCGG 1 cut(s) 95
HphI GGTGA 1 cut(s) 194
HpyCH4III ACNGT 2 cut(s) 167, 208
HpyCH4IV ACGT 1 cut(s) 63
HpySE526I ACGT 1 cut(s) 63
HspAI GCGC 1 cut(s) 39
LmnI GCTCC 2 cut(s) 20, 84
LpnPI CCDG 4 cut(s) 9, 108, 134, 161
Lsp1109I GCAGC 1 cut(s) 177
MaeI CTAG 1 cut(s) 129
MaeII ACGT 1 cut(s) 63
MboII GAAGA 5 cut(s) 25, 45, 121, 124, 208
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 4 cut(s) 68, 108, 127, 151
MspI CCGG 1 cut(s) 95
MspR9I CCNGG 1 cut(s) 149
MvaI CCWGG 1 cut(s) 149
MvnI CGCG 1 cut(s) 41
PfeI GAWTC 1 cut(s) 124
PflMI CCANNNNNTGG 1 cut(s) 154
PkrI GCNGC 1 cut(s) 192
PmaCI CACGTG 1 cut(s) 64
PmlI CACGTG 1 cut(s) 64
Ppu21I YACGTR 1 cut(s) 64
Psp6I CCWGG 1 cut(s) 147
PspCI CACGTG 1 cut(s) 64
PspGI CCWGG 1 cut(s) 147
PspPI GGNCC 2 cut(s) 92, 204
RsaI GTAC 1 cut(s) 164
RsaNI GTAC 1 cut(s) 163
SatI GCNGC 1 cut(s) 191
Sau96I GGNCC 2 cut(s) 92, 204
ScrFI CCNGG 1 cut(s) 149
SetI ASST 4 cut(s) 25, 66, 119, 138
SinI GGWCC 2 cut(s) 92, 204
SspMI CTAG 1 cut(s) 129
StyD4I CCNGG 1 cut(s) 147
TaaI ACNGT 2 cut(s) 167, 208
TaiI ACGT 1 cut(s) 66
TfiI GAWTC 1 cut(s) 124
TseI GCWGC 1 cut(s) 190
TspDTI ATGAA 1 cut(s) 122
Van91I CCANNNNNTGG 1 cut(s) 154
VpaK11BI GGWCC 2 cut(s) 92, 204
XspI CTAG 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.