Rh3DG260000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0000643
Physical Location & Seq
Forward (+)
25731871 .. 25732244
374 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG260000.1

Sequence Viewer

Length: 201 bp
ATGGGTTTTGAAATTGAAGAAGAGAAAGGTCGAGACTTGGGGAAGATCGATTTGGATATTGAGGAAATCGAGAAAGAGATAACTCGATTGGAACTCATGGAACGAAGGACCTTGAAACGAGGGACAGAGGAAGCTTGTGGAACGAAGGAGCTTGAAACTCCAAGAATCGTCGAGCTAATGATGATGAAGCATTGTCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.8

Weight (kDa)

4.81

Isoelectric Point (pI)

72.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 4 cut(s) 11, 17, 115, 155
AjuI GAANNNNNNNTTGG 2 cut(s) 35, 67
AluBI AGCT 3 cut(s) 134, 151, 175
AluI AGCT 3 cut(s) 134, 151, 175
Alw26I GTCTC 1 cut(s) 27
AspS9I GGNCC 1 cut(s) 108
AvaII GGWCC 1 cut(s) 108
BcoDI GTCTC 1 cut(s) 27
Bme18I GGWCC 1 cut(s) 108
BmgT120I GGNCC 1 cut(s) 108
Bsa29I ATCGAT 1 cut(s) 48
BseCI ATCGAT 1 cut(s) 48
BshVI ATCGAT 1 cut(s) 48
BslFI GGGAC 1 cut(s) 136
BsmAI GTCTC 1 cut(s) 27
BsmFI GGGAC 1 cut(s) 136
Bsp143I GATC 1 cut(s) 45
BspDI ATCGAT 1 cut(s) 48
BssMI GATC 1 cut(s) 45
Bst6I CTCTTC 1 cut(s) 15
BstKTI GATC 1 cut(s) 48
BstMAI GTCTC 1 cut(s) 27
BstMBI GATC 1 cut(s) 45
Bsu15I ATCGAT 1 cut(s) 48
BsuTUI ATCGAT 1 cut(s) 48
Cfr13I GGNCC 1 cut(s) 108
ClaI ATCGAT 1 cut(s) 48
CviAII CATG 1 cut(s) 97
CviJI RGCY 3 cut(s) 134, 151, 175
CviKI_1 RGCY 3 cut(s) 134, 151, 175
DpnI GATC 1 cut(s) 47
DpnII GATC 1 cut(s) 45
Eam1104I CTCTTC 1 cut(s) 15
EarI CTCTTC 1 cut(s) 15
Eco47I GGWCC 1 cut(s) 108
EcoO109I RGGNCCY 1 cut(s) 108
FaeI CATG 1 cut(s) 100
FaiI YATR 1 cut(s) 98
FaqI GGGAC 1 cut(s) 136
FatI CATG 1 cut(s) 96
Hin1II CATG 1 cut(s) 100
HindIII AAGCTT 1 cut(s) 132
HinfI GANTC 1 cut(s) 165
Hpy188III TCNNGA 2 cut(s) 32, 70
Hpy99I CGWCG 1 cut(s) 173
HpyAV CCTTC 2 cut(s) 99, 139
Hsp92II CATG 1 cut(s) 100
Kzo9I GATC 1 cut(s) 45
LmnI GCTCC 1 cut(s) 148
MalI GATC 1 cut(s) 47
MboI GATC 1 cut(s) 45
MboII GAAGA 3 cut(s) 29, 32, 55
MluCI AATT 1 cut(s) 12
MnlI CCTC 3 cut(s) 55, 113, 121
NdeII GATC 1 cut(s) 45
NlaIII CATG 1 cut(s) 100
PfeI GAWTC 1 cut(s) 165
PpuMI RGGWCCY 1 cut(s) 108
Psp5II RGGWCCY 1 cut(s) 108
PspPI GGNCC 1 cut(s) 108
PspPPI RGGWCCY 1 cut(s) 108
Sau3AI GATC 1 cut(s) 45
Sau96I GGNCC 1 cut(s) 108
SetI ASST 5 cut(s) 31, 113, 136, 153, 177
SinI GGWCC 1 cut(s) 108
Sse9I AATT 1 cut(s) 12
TaqI TCGA 5 cut(s) 31, 48, 69, 85, 171
TasI AATT 1 cut(s) 12
TfiI GAWTC 1 cut(s) 165
TspDTI ATGAA 1 cut(s) 200
VpaK11BI GGWCC 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.