Rh1AG164400

Plant nuclear matrix protein 1 (NMP1)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
31451205 .. 31459314
8110 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG164400.1

Sequence Viewer

Length: 261 bp
ATGGTGAAGAAGAATAAGTGGGAGCATGGAGGATTTGGCATGATGTTTCAGAGCTGGAACAAAGGCTTACAGAACAATCAAAGATACTCTCAAGTCTTCAACAACAGGTTGATGATTTGGCATCAAAGGCATGATGTTTCTGAGCTGGAGCAAAAGCTTACAGAACAATCAAAGATACTCTCAAGTCTTCAACAAAAGGTTGATGATTTGGCATCAAAGCATGCTTACAACCCAGATGAGGAGTATGCAGGGGTAGAATAG

Protein Analysis

86

Amino Acids

10.21

Weight (kDa)

6.91

Isoelectric Point (pI)

53.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Plant_NMP1 PF06694 44 - 86 7.5e-14 Plant nuclear matrix protein 1 (NMP1)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 238
AgsI TTSAA 2 cut(s) 100, 191
AluBI AGCT 3 cut(s) 54, 145, 157
AluI AGCT 3 cut(s) 54, 145, 157
AsuHPI GGTGA 1 cut(s) 16
BbsI GAAGAC 2 cut(s) 88, 179
BmsI GCATC 2 cut(s) 130, 221
BpiI GAAGAC 2 cut(s) 88, 179
BpmI CTGGAG 1 cut(s) 167
BpuEI CTTGAG 2 cut(s) 75, 166
Bsc4I CCNNNNNNNGG 1 cut(s) 238
BseLI CCNNNNNNNGG 1 cut(s) 238
BseMII CTCAG 1 cut(s) 132
BseRI GAGGAG 1 cut(s) 254
BslI CCNNNNNNNGG 1 cut(s) 238
BspCNI CTCAG 1 cut(s) 133
BstC8I GCNNGC 1 cut(s) 222
BstDEI CTNAG 1 cut(s) 141
BstMWI GCNNNNNNNGC 1 cut(s) 127
BstNSI RCATGY 1 cut(s) 224
BstV2I GAAGAC 2 cut(s) 88, 179
Cac8I GCNNGC 1 cut(s) 222
CviAII CATG 4 cut(s) 26, 40, 131, 221
CviJI RGCY 4 cut(s) 54, 66, 145, 157
CviKI_1 RGCY 4 cut(s) 54, 66, 145, 157
DdeI CTNAG 1 cut(s) 141
FaeI CATG 4 cut(s) 29, 43, 134, 224
FaiI YATR 5 cut(s) 27, 41, 132, 222, 246
FatI CATG 4 cut(s) 25, 39, 130, 220
GsuI CTGGAG 1 cut(s) 167
Hin1II CATG 4 cut(s) 29, 43, 134, 224
HindIII AAGCTT 1 cut(s) 155
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 2 cut(s) 51, 142
HpyCH4V TGCA 1 cut(s) 248
HpyF10VI GCNNNNNNNGC 1 cut(s) 127
HpyF3I CTNAG 1 cut(s) 141
Hsp92II CATG 4 cut(s) 29, 43, 134, 224
LmnI GCTCC 2 cut(s) 22, 148
LpnPI CCDG 5 cut(s) 40, 91, 131, 234, 246
LweI GCATC 2 cut(s) 130, 221
MboII GAAGA 4 cut(s) 19, 22, 88, 179
MnlI CCTC 2 cut(s) 23, 232
MwoI GCNNNNNNNGC 1 cut(s) 127
NlaIII CATG 4 cut(s) 29, 43, 134, 224
NspI RCATGY 1 cut(s) 224
PaeI GCATGC 1 cut(s) 224
SetI ASST 5 cut(s) 56, 110, 147, 159, 201
SfaNI GCATC 2 cut(s) 130, 221
SmlI CTYRAG 2 cut(s) 90, 181
SmoI CTYRAG 2 cut(s) 90, 181
SphI GCATGC 1 cut(s) 224
XceI RCATGY 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.