Rh7DG200800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0000643
Physical Location & Seq
Forward (+)
19021170 .. 19021358
189 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG200800.1

Sequence Viewer

Length: 189 bp
ATGGGGTTTGAGGTTGCAGAAGAGAAAGGTCGAGACCTGGGGAAGATCGATTCGGAGATTGAGGAAATCAAGAAGGAGATAAGCCGATTGAATTCGAGGCTGGAATTGCAGGAACTAGAAAAGGCTCAGAAGAGAAGCGCGGTAGAGTTGTGGAGGCAAATTTCATGGAGCTTTCATAGCAAAGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.32

Weight (kDa)

5.83

Isoelectric Point (pI)

69.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 140
AciI CCGC 1 cut(s) 140
AcsI RAATTY 2 cut(s) 91, 159
AgsI TTSAA 1 cut(s) 91
AjnI CCWGG 1 cut(s) 36
AluBI AGCT 1 cut(s) 171
AluI AGCT 1 cut(s) 171
Alw26I GTCTC 1 cut(s) 27
ApoI RAATTY 2 cut(s) 91, 159
AspLEI GCGC 1 cut(s) 140
BciT130I CCWGG 1 cut(s) 38
BcoDI GTCTC 1 cut(s) 27
BfaI CTAG 1 cut(s) 116
Bme1390I CCNGG 1 cut(s) 38
BmrFI CCNGG 1 cut(s) 38
Bsa29I ATCGAT 1 cut(s) 48
BsaI GGTCTC 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 37
BseBI CCWGG 1 cut(s) 38
BseCI ATCGAT 1 cut(s) 48
BseDI CCNNGG 1 cut(s) 37
BseMII CTCAG 1 cut(s) 140
Bsh1236I CGCG 1 cut(s) 140
BshVI ATCGAT 1 cut(s) 48
BsmAI GTCTC 1 cut(s) 27
Bso31I GGTCTC 1 cut(s) 27
Bsp143I GATC 1 cut(s) 45
BspACI CCGC 1 cut(s) 140
BspCNI CTCAG 1 cut(s) 139
BspDI ATCGAT 1 cut(s) 48
BspFNI CGCG 1 cut(s) 140
BspTNI GGTCTC 1 cut(s) 27
BssECI CCNNGG 1 cut(s) 37
BssMI GATC 1 cut(s) 45
Bst2UI CCWGG 1 cut(s) 38
Bst6I CTCTTC 2 cut(s) 15, 125
BstDEI CTNAG 1 cut(s) 126
BstFNI CGCG 1 cut(s) 140
BstHHI GCGC 1 cut(s) 140
BstKTI GATC 1 cut(s) 48
BstMAI GTCTC 1 cut(s) 27
BstMBI GATC 1 cut(s) 45
BstMWI GCNNNNNNNGC 2 cut(s) 106, 177
BstNI CCWGG 1 cut(s) 38
BstSCI CCNGG 1 cut(s) 36
BstUI CGCG 1 cut(s) 140
Bsu15I ATCGAT 1 cut(s) 48
BsuTUI ATCGAT 1 cut(s) 48
CfoI GCGC 1 cut(s) 140
ClaI ATCGAT 1 cut(s) 48
CviAII CATG 1 cut(s) 165
CviJI RGCY 4 cut(s) 84, 100, 125, 171
CviKI_1 RGCY 4 cut(s) 84, 100, 125, 171
DdeI CTNAG 1 cut(s) 126
DpnI GATC 1 cut(s) 47
DpnII GATC 1 cut(s) 45
Eam1104I CTCTTC 2 cut(s) 15, 125
EarI CTCTTC 2 cut(s) 15, 125
Eco31I GGTCTC 1 cut(s) 27
EcoRI GAATTC 1 cut(s) 91
EcoRII CCWGG 1 cut(s) 36
FaeI CATG 1 cut(s) 168
FaiI YATR 2 cut(s) 166, 177
FatI CATG 1 cut(s) 164
FspBI CTAG 1 cut(s) 116
GlaI GCGC 1 cut(s) 139
HhaI GCGC 1 cut(s) 140
Hin1II CATG 1 cut(s) 168
Hin6I GCGC 1 cut(s) 138
HinP1I GCGC 1 cut(s) 138
HinfI GANTC 1 cut(s) 50
Hpy188I TCNGA 2 cut(s) 55, 129
Hpy188III TCNNGA 2 cut(s) 32, 70
HpyAV CCTTC 1 cut(s) 67
HpyCH4V TGCA 2 cut(s) 17, 109
HpyF10VI GCNNNNNNNGC 2 cut(s) 106, 177
HpyF3I CTNAG 1 cut(s) 126
Hsp92II CATG 1 cut(s) 168
HspAI GCGC 1 cut(s) 138
Kzo9I GATC 1 cut(s) 45
LmnI GCTCC 1 cut(s) 168
LpnPI CCDG 4 cut(s) 23, 50, 86, 95
MaeI CTAG 1 cut(s) 116
MalI GATC 1 cut(s) 47
MboI GATC 1 cut(s) 45
MboII GAAGA 3 cut(s) 32, 55, 142
MluCI AATT 3 cut(s) 91, 104, 159
MnlI CCTC 4 cut(s) 4, 55, 90, 147
MspR9I CCNGG 1 cut(s) 38
MvaI CCWGG 1 cut(s) 38
MvnI CGCG 1 cut(s) 140
MwoI GCNNNNNNNGC 2 cut(s) 106, 177
NdeII GATC 1 cut(s) 45
NlaIII CATG 1 cut(s) 168
PfeI GAWTC 1 cut(s) 50
Psp6I CCWGG 1 cut(s) 36
PspGI CCWGG 1 cut(s) 36
Sau3AI GATC 1 cut(s) 45
ScrFI CCNGG 1 cut(s) 38
SetI ASST 4 cut(s) 15, 31, 39, 173
Sse9I AATT 3 cut(s) 91, 104, 159
SsiI CCGC 1 cut(s) 140
SspMI CTAG 1 cut(s) 116
StyD4I CCNGG 1 cut(s) 36
TaqI TCGA 3 cut(s) 31, 48, 95
TasI AATT 3 cut(s) 91, 104, 159
TfiI GAWTC 1 cut(s) 50
TspDTI ATGAA 2 cut(s) 153, 164
XapI RAATTY 2 cut(s) 91, 159
XspI CTAG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.