Rroxscaffold_5G00352000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0000910
Physical Location & Seq
Reverse (-)
28806048 .. 28806822
775 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00352000.1

Sequence Viewer

Length: 156 bp
ATGGCTTTGTTTATGGAACAATTTGGAGTCCGGATAGTGGGTGATACAAGCACTACTAGTGAAATTGTTCTAGTCTATGCACATGATTTAAACACATGCAACCTTGCTGAAAACCTGGTGTGGATAAAGTGTTATCAAAGCTGTGCAGGTGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.67

Weight (kDa)

4.42

Isoelectric Point (pI)

27.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 137
Acc36I ACCTGC 1 cut(s) 137
AccIII TCCGGA 1 cut(s) 30
AfiI CCNNNNNNNGG 1 cut(s) 37
AhlI ACTAGT 1 cut(s) 56
AjnI CCWGG 1 cut(s) 114
AluBI AGCT 1 cut(s) 141
AluI AGCT 1 cut(s) 141
Aor13HI TCCGGA 1 cut(s) 30
Asp700I GAANNNNTTC 1 cut(s) 66
AsuHPI GGTGA 1 cut(s) 53
BciT130I CCWGG 1 cut(s) 116
BcuI ACTAGT 1 cut(s) 56
BfaI CTAG 2 cut(s) 57, 71
BfuAI ACCTGC 1 cut(s) 137
Bme1390I CCNGG 1 cut(s) 116
BmrFI CCNGG 1 cut(s) 116
BsaWI WCCGGW 1 cut(s) 30
Bsc4I CCNNNNNNNGG 1 cut(s) 37
BseAI TCCGGA 1 cut(s) 30
BseBI CCWGG 1 cut(s) 116
BseLI CCNNNNNNNGG 1 cut(s) 37
BsiSI CCGG 1 cut(s) 31
BslI CCNNNNNNNGG 1 cut(s) 37
Bsp13I TCCGGA 1 cut(s) 30
BspEI TCCGGA 1 cut(s) 30
BspMI ACCTGC 1 cut(s) 137
Bst2UI CCWGG 1 cut(s) 116
BstNI CCWGG 1 cut(s) 116
BstNSI RCATGY 1 cut(s) 99
BstSCI CCNGG 1 cut(s) 114
BveI ACCTGC 1 cut(s) 137
CsiI ACCWGGT 1 cut(s) 114
CviAII CATG 2 cut(s) 83, 96
CviJI RGCY 2 cut(s) 5, 141
CviKI_1 RGCY 2 cut(s) 5, 141
DraI TTTAAA 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 114
FaeI CATG 2 cut(s) 86, 99
FaiI YATR 4 cut(s) 14, 78, 84, 97
FatI CATG 2 cut(s) 82, 95
FspBI CTAG 2 cut(s) 57, 71
HapII CCGG 1 cut(s) 31
Hin1II CATG 2 cut(s) 86, 99
HinfI GANTC 1 cut(s) 27
HpaII CCGG 1 cut(s) 31
HphI GGTGA 1 cut(s) 53
Hpy188III TCNNGA 1 cut(s) 31
HpyCH4V TGCA 3 cut(s) 80, 99, 146
Hsp92II CATG 2 cut(s) 86, 99
Kpn2I TCCGGA 1 cut(s) 30
LpnPI CCDG 4 cut(s) 44, 101, 128, 132
MabI ACCWGGT 1 cut(s) 114
MaeI CTAG 2 cut(s) 57, 71
MluCI AATT 2 cut(s) 20, 63
MlyI GAGTC 1 cut(s) 36
MroI TCCGGA 1 cut(s) 30
MroXI GAANNNNTTC 1 cut(s) 66
MseI TTAA 2 cut(s) 89, 154
MspI CCGG 1 cut(s) 31
MspR9I CCNGG 1 cut(s) 116
MvaI CCWGG 1 cut(s) 116
NlaIII CATG 2 cut(s) 86, 99
NspI RCATGY 1 cut(s) 99
PaqCI CACCTGC 1 cut(s) 137
PdmI GAANNNNTTC 1 cut(s) 66
PleI GAGTC 1 cut(s) 35
PpsI GAGTC 1 cut(s) 35
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
SaqAI TTAA 2 cut(s) 89, 154
SchI GAGTC 1 cut(s) 36
ScrFI CCNGG 1 cut(s) 116
SetI ASST 4 cut(s) 105, 117, 143, 151
SexAI ACCWGGT 1 cut(s) 114
SgeI CNNG 9 cut(s) 43, 60, 69, 83, 95, 108, 116, 127, 128
SpeI ACTAGT 1 cut(s) 56
Sse9I AATT 2 cut(s) 20, 63
SspMI CTAG 2 cut(s) 57, 71
StyD4I CCNGG 1 cut(s) 114
TasI AATT 2 cut(s) 20, 63
Tru1I TTAA 2 cut(s) 89, 154
Tru9I TTAA 2 cut(s) 89, 154
XceI RCATGY 1 cut(s) 99
XmnI GAANNNNTTC 1 cut(s) 66
XspI CTAG 2 cut(s) 57, 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.