Rroxscaffold_7G00189350

Encoded by

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
29090405 .. 29097244
6840 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00189350.1

Sequence Viewer

Length: 297 bp
ATGATCGGAAGTGGTCGAAAACTCACCTTGAAGCCACGGGTTGCCTTCGGACGTCTCATCATTGAAGAAGCTAAGGAGGCTCAGCATACACTTTGGGAATGGGGCTTCAATTCAAGCGGTGGAGTTCAAAAAGTTGAAAGATATGTCATCTCTTCGCTTCCGAAGGTATCATGGGGAGTGGTTTCTAAAAATTTGACAAAGGAGATTGATGATGAGTCCTCGAAACTCTTGTTTCCAGAGAATTTAGAAAAATGGGATCTTCAAGGCTTTCCCCTAGCACATGCACCGAAGGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

11.01

Weight (kDa)

9.0

Isoelectric Point (pI)

31.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 55
AciI CCGC 1 cut(s) 117
AclWI GGATC 1 cut(s) 264
AcsI RAATTY 2 cut(s) 190, 241
AcyI GRCGYC 1 cut(s) 52
AgsI TTSAA 7 cut(s) 31, 65, 109, 114, 128, 137, 263
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
Alw26I GTCTC 1 cut(s) 59
AlwI GGATC 1 cut(s) 264
ApoI RAATTY 2 cut(s) 190, 241
AsuHPI GGTGA 1 cut(s) 16
BcoDI GTCTC 1 cut(s) 59
BfaI CTAG 1 cut(s) 275
BlpI GCTNAGC 1 cut(s) 81
Bpu10I CCTNAGC 1 cut(s) 72
Bpu1102I GCTNAGC 1 cut(s) 81
BsaHI GRCGYC 1 cut(s) 52
BsaJI CCNNGG 1 cut(s) 35
BseDI CCNNGG 1 cut(s) 35
BseMII CTCAG 1 cut(s) 95
BsmAI GTCTC 1 cut(s) 59
BsmBI CGTCTC 1 cut(s) 59
Bsp143I GATC 2 cut(s) 3, 256
Bsp1720I GCTNAGC 1 cut(s) 81
BspACI CCGC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 94
BspPI GGATC 1 cut(s) 264
BssECI CCNNGG 1 cut(s) 35
BssMI GATC 2 cut(s) 3, 256
BssNI GRCGYC 1 cut(s) 52
Bst6I CTCTTC 1 cut(s) 157
BstACI GRCGYC 1 cut(s) 52
BstDEI CTNAG 2 cut(s) 72, 81
BstDSI CCRYGG 1 cut(s) 35
BstKTI GATC 2 cut(s) 6, 259
BstMAI GTCTC 1 cut(s) 59
BstMBI GATC 2 cut(s) 3, 256
BstMWI GCNNNNNNNGC 1 cut(s) 77
BstNSI RCATGY 1 cut(s) 284
BstX2I RGATCY 1 cut(s) 256
BstYI RGATCY 1 cut(s) 256
BtgI CCRYGG 1 cut(s) 35
CviAII CATG 2 cut(s) 171, 281
CviJI RGCY 5 cut(s) 34, 71, 80, 105, 267
CviKI_1 RGCY 5 cut(s) 34, 71, 80, 105, 267
DdeI CTNAG 2 cut(s) 72, 81
DpnI GATC 2 cut(s) 5, 258
DpnII GATC 2 cut(s) 3, 256
Eam1104I CTCTTC 1 cut(s) 157
EarI CTCTTC 1 cut(s) 157
Esp3I CGTCTC 1 cut(s) 59
FaeI CATG 2 cut(s) 174, 284
FaiI YATR 4 cut(s) 87, 144, 172, 282
FatI CATG 2 cut(s) 170, 280
FspBI CTAG 1 cut(s) 275
Hin1I GRCGYC 1 cut(s) 52
Hin1II CATG 2 cut(s) 174, 284
HinfI GANTC 1 cut(s) 215
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 3 cut(s) 8, 50, 162
Hpy188III TCNNGA 1 cut(s) 236
HpyAV CCTTC 3 cut(s) 55, 157, 283
HpyCH4IV ACGT 1 cut(s) 52
HpyCH4V TGCA 1 cut(s) 284
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
HpyF3I CTNAG 2 cut(s) 72, 81
HpySE526I ACGT 1 cut(s) 52
Hsp92I GRCGYC 1 cut(s) 52
Hsp92II CATG 2 cut(s) 174, 284
Kzo9I GATC 2 cut(s) 3, 256
LpnPI CCDG 1 cut(s) 249
MaeI CTAG 1 cut(s) 275
MaeII ACGT 1 cut(s) 52
MalI GATC 2 cut(s) 5, 258
MboI GATC 2 cut(s) 3, 256
MboII GAAGA 3 cut(s) 77, 144, 251
MflI RGATCY 1 cut(s) 256
MluCI AATT 3 cut(s) 109, 190, 241
MlyI GAGTC 1 cut(s) 224
MnlI CCTC 2 cut(s) 70, 229
MwoI GCNNNNNNNGC 1 cut(s) 77
NdeII GATC 2 cut(s) 3, 256
NlaIII CATG 2 cut(s) 174, 284
NspI RCATGY 1 cut(s) 284
PleI GAGTC 1 cut(s) 223
PpsI GAGTC 1 cut(s) 223
PsuI RGATCY 1 cut(s) 256
Sau3AI GATC 2 cut(s) 3, 256
SchI GAGTC 1 cut(s) 224
SetI ASST 4 cut(s) 29, 55, 73, 168
Sse9I AATT 3 cut(s) 109, 190, 241
SsiI CCGC 1 cut(s) 117
SspMI CTAG 1 cut(s) 275
TaiI ACGT 1 cut(s) 55
TaqI TCGA 2 cut(s) 16, 221
TasI AATT 3 cut(s) 109, 190, 241
XapI RAATTY 2 cut(s) 190, 241
XceI RCATGY 1 cut(s) 284
XspI CTAG 1 cut(s) 275
ZraI GACGTC 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.