Rh2BG149500

Regulator of chromosome condensation (RCC1) repeat

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
12799034 .. 12800011
978 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG149500.1

Sequence Viewer

Length: 270 bp
ATGCCAGGACCAGGATCGCTGGTGAAGAACCAGCGTCTAGTAAACGTGATTGTCCAAAGGTTTCAGAGATGTATGACCACCGCCACAGCTGTCCTGAGCTTCGGGGACGGCAACCATGGCGCTACCCGGGTCCCTTCTCTGCCTCCTGACATCACCAGAGTCACCGCCGGGCCTTACCAATCCCTGGCCGTCACTTCCGAAGGTCAGCTTTGGGCTTGGGGCCGAGACCTCGAGGCCCAGCTCGGCCGTGGAGGTCCTTCTCCGAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

9.43

Weight (kDa)

10.02

Isoelectric Point (pI)

35.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WD40_RLD PF25390 32 - 84 4.3e-08 RCC1-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 230
AccB7I CCANNNNNTGG 1 cut(s) 184
AciI CCGC 2 cut(s) 81, 165
AclWI GGATC 1 cut(s) 22
AcoI YGGCCR 2 cut(s) 186, 244
AfiI CCNNNNNNNGG 2 cut(s) 11, 184
AjnI CCWGG 3 cut(s) 4, 10, 183
AluBI AGCT 4 cut(s) 89, 99, 208, 241
AluI AGCT 4 cut(s) 89, 99, 208, 241
Alw26I GTCTC 1 cut(s) 219
AlwI GGATC 1 cut(s) 22
Ama87I CYCGRG 2 cut(s) 126, 230
AoxI GGCC 5 cut(s) 170, 186, 220, 234, 244
AspLEI GCGC 1 cut(s) 122
AspS9I GGNCC 6 cut(s) 8, 130, 170, 220, 235, 254
AsuC2I CCSGG 3 cut(s) 127, 128, 169
AsuHPI GGTGA 3 cut(s) 34, 145, 154
AvaI CYCGRG 2 cut(s) 126, 230
AvaII GGWCC 3 cut(s) 8, 130, 254
BceAI ACGGC 3 cut(s) 124, 173, 231
BciT130I CCWGG 3 cut(s) 6, 12, 185
BcnI CCSGG 3 cut(s) 127, 128, 169
BcoDI GTCTC 1 cut(s) 219
BfaI CTAG 1 cut(s) 38
BfoI RGCGCY 1 cut(s) 123
Bme1390I CCNGG 6 cut(s) 6, 12, 127, 128, 169, 185
Bme18I GGWCC 3 cut(s) 8, 130, 254
BmeT110I CYCGRG 2 cut(s) 126, 230
BmgT120I GGNCC 6 cut(s) 8, 130, 170, 220, 235, 254
BmiI GGNNCC 3 cut(s) 131, 132, 221
BmrFI CCNGG 6 cut(s) 6, 12, 127, 128, 169, 185
Bpu10I CCTNAGC 1 cut(s) 95
BpuMI CCSGG 3 cut(s) 127, 128, 169
BsaI GGTCTC 1 cut(s) 219
BsaJI CCNNGG 4 cut(s) 115, 126, 183, 247
Bsc4I CCNNNNNNNGG 2 cut(s) 11, 184
BseBI CCWGG 3 cut(s) 6, 12, 185
BseDI CCNNGG 4 cut(s) 115, 126, 183, 247
BseLI CCNNNNNNNGG 2 cut(s) 11, 184
BseMII CTCAG 1 cut(s) 86
BseX3I CGGCCG 1 cut(s) 244
BseYI CCCAGC 1 cut(s) 237
Bsh1285I CGRYCG 1 cut(s) 247
BshFI GGCC 5 cut(s) 172, 188, 222, 236, 246
BsiEI CGRYCG 1 cut(s) 247
BsiHKCI CYCGRG 2 cut(s) 126, 230
BsiSI CCGG 2 cut(s) 127, 168
BslFI GGGAC 2 cut(s) 116, 119
BslI CCNNNNNNNGG 2 cut(s) 11, 184
BsmAI GTCTC 1 cut(s) 219
BsmFI GGGAC 2 cut(s) 116, 119
BsnI GGCC 5 cut(s) 172, 188, 222, 236, 246
Bso31I GGTCTC 1 cut(s) 219
BsoBI CYCGRG 2 cut(s) 126, 230
Bsp143I GATC 1 cut(s) 14
Bsp19I CCATGG 1 cut(s) 115
BspACI CCGC 2 cut(s) 81, 165
BspANI GGCC 5 cut(s) 172, 188, 222, 236, 246
BspCNI CTCAG 1 cut(s) 87
BspLI GGNNCC 3 cut(s) 131, 132, 221
BspPI GGATC 1 cut(s) 22
BspTNI GGTCTC 1 cut(s) 219
BssECI CCNNGG 4 cut(s) 115, 126, 183, 247
BssMI GATC 1 cut(s) 14
BssT1I CCWWGG 1 cut(s) 115
Bst2UI CCWGG 3 cut(s) 6, 12, 185
BstDEI CTNAG 1 cut(s) 95
BstDSI CCRYGG 2 cut(s) 115, 247
BstH2I RGCGCY 1 cut(s) 123
BstHHI GCGC 1 cut(s) 122
BstKTI GATC 1 cut(s) 17
BstMAI GTCTC 1 cut(s) 219
BstMBI GATC 1 cut(s) 14
BstMCI CGRYCG 1 cut(s) 247
BstMWI GCNNNNNNNGC 1 cut(s) 117
BstNI CCWGG 3 cut(s) 6, 12, 185
BstSCI CCNGG 6 cut(s) 4, 10, 125, 126, 167, 183
BstZI CGGCCG 1 cut(s) 244
BsuRI GGCC 5 cut(s) 172, 188, 222, 236, 246
BtgI CCRYGG 2 cut(s) 115, 247
CfoI GCGC 1 cut(s) 122
Cfr13I GGNCC 6 cut(s) 8, 130, 170, 220, 235, 254
Cfr9I CCCGGG 1 cut(s) 126
CseI GACGC 1 cut(s) 23
CviAII CATG 1 cut(s) 116
DdeI CTNAG 1 cut(s) 95
DpnI GATC 1 cut(s) 16
DpnII GATC 1 cut(s) 14
EaeI YGGCCR 2 cut(s) 186, 244
EagI CGGCCG 1 cut(s) 244
EclXI CGGCCG 1 cut(s) 244
Eco130I CCWWGG 1 cut(s) 115
Eco31I GGTCTC 1 cut(s) 219
Eco47I GGWCC 3 cut(s) 8, 130, 254
Eco52I CGGCCG 1 cut(s) 244
Eco88I CYCGRG 2 cut(s) 126, 230
EcoO109I RGGNCCY 2 cut(s) 130, 254
EcoRII CCWGG 3 cut(s) 4, 10, 183
EcoT14I CCWWGG 1 cut(s) 115
ErhI CCWWGG 1 cut(s) 115
FaeI CATG 1 cut(s) 119
FaiI YATR 2 cut(s) 74, 117
FalI AAGNNNNNCTT 2 cut(s) 192, 224
FaqI GGGAC 2 cut(s) 116, 119
FatI CATG 1 cut(s) 115
FspBI CTAG 1 cut(s) 38
GlaI GCGC 1 cut(s) 121
GsaI CCCAGC 1 cut(s) 241
HaeII RGCGCY 1 cut(s) 123
HaeIII GGCC 5 cut(s) 172, 188, 222, 236, 246
HapII CCGG 2 cut(s) 127, 168
HgaI GACGC 1 cut(s) 23
HhaI GCGC 1 cut(s) 122
Hin1II CATG 1 cut(s) 119
Hin6I GCGC 1 cut(s) 120
HinP1I GCGC 1 cut(s) 120
HinfI GANTC 1 cut(s) 159
HpaII CCGG 2 cut(s) 127, 168
HphI GGTGA 3 cut(s) 34, 145, 154
Hpy166II GTNNAC 1 cut(s) 43
Hpy188I TCNGA 3 cut(s) 66, 199, 264
Hpy188III TCNNGA 2 cut(s) 94, 146
Hpy8I GTNNAC 1 cut(s) 43
HpyAV CCTTC 3 cut(s) 144, 194, 267
HpyCH4IV ACGT 1 cut(s) 45
HpyF10VI GCNNNNNNNGC 1 cut(s) 117
HpyF3I CTNAG 1 cut(s) 95
HpySE526I ACGT 1 cut(s) 45
Hsp92II CATG 1 cut(s) 119
HspAI GCGC 1 cut(s) 120
KflI GGGWCCC 1 cut(s) 130
Kzo9I GATC 1 cut(s) 14
MaeI CTAG 1 cut(s) 38
MaeII ACGT 1 cut(s) 45
MaeIII GTNAC 2 cut(s) 160, 190
MalI GATC 1 cut(s) 16
MboI GATC 1 cut(s) 14
MboII GAAGA 1 cut(s) 37
MlyI GAGTC 1 cut(s) 168
MnlI CCTC 4 cut(s) 153, 226, 239, 245
MseI TTAA 1 cut(s) 268
MspA1I CMGCKG 1 cut(s) 89
MspI CCGG 2 cut(s) 127, 168
MspR9I CCNGG 6 cut(s) 6, 12, 127, 128, 169, 185
MvaI CCWGG 3 cut(s) 6, 12, 185
MwoI GCNNNNNNNGC 1 cut(s) 117
NciI CCSGG 3 cut(s) 127, 128, 169
NcoI CCATGG 1 cut(s) 115
NdeII GATC 1 cut(s) 14
NlaIII CATG 1 cut(s) 119
NlaIV GGNNCC 3 cut(s) 131, 132, 221
NmeAIII GCCGAG 2 cut(s) 222, 248
NmuCI GTSAC 2 cut(s) 160, 190
PaeR7I CTCGAG 1 cut(s) 230
PflMI CCANNNNNTGG 1 cut(s) 184
PleI GAGTC 1 cut(s) 167
PpsI GAGTC 1 cut(s) 167
PpuMI RGGWCCY 2 cut(s) 130, 254
Psp5II RGGWCCY 2 cut(s) 130, 254
Psp6I CCWGG 3 cut(s) 4, 10, 183
PspFI CCCAGC 1 cut(s) 237
PspGI CCWGG 3 cut(s) 4, 10, 183
PspN4I GGNNCC 3 cut(s) 131, 132, 221
PspPI GGNCC 6 cut(s) 8, 130, 170, 220, 235, 254
PspPPI RGGWCCY 2 cut(s) 130, 254
PspXI VCTCGAGB 1 cut(s) 230
PvuII CAGCTG 1 cut(s) 89
SaqAI TTAA 1 cut(s) 268
Sau3AI GATC 1 cut(s) 14
Sau96I GGNCC 6 cut(s) 8, 130, 170, 220, 235, 254
SchI GAGTC 1 cut(s) 168
ScrFI CCNGG 6 cut(s) 6, 12, 127, 128, 169, 185
SetI ASST 9 cut(s) 48, 62, 91, 101, 205, 210, 231, 243, 256
Sfr274I CTCGAG 1 cut(s) 230
SinI GGWCC 3 cut(s) 8, 130, 254
SlaI CTCGAG 1 cut(s) 230
SmaI CCCGGG 1 cut(s) 128
SmlI CTYRAG 1 cut(s) 230
SmoI CTYRAG 1 cut(s) 230
SsiI CCGC 2 cut(s) 81, 165
SspMI CTAG 1 cut(s) 38
StyD4I CCNGG 6 cut(s) 4, 10, 125, 126, 167, 183
StyI CCWWGG 1 cut(s) 115
TaiI ACGT 1 cut(s) 48
TaqI TCGA 1 cut(s) 231
Tru1I TTAA 1 cut(s) 268
Tru9I TTAA 1 cut(s) 268
TseFI GTSAC 2 cut(s) 160, 190
Tsp45I GTSAC 2 cut(s) 160, 190
TspMI CCCGGG 1 cut(s) 126
Van91I CCANNNNNTGG 1 cut(s) 184
VpaK11BI GGWCC 3 cut(s) 8, 130, 254
XcmI CCANNNNNNNNNTGG 1 cut(s) 245
XhoI CTCGAG 1 cut(s) 230
XmaI CCCGGG 1 cut(s) 126
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.