Rw1G013200

ACT domain

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Forward (+)
29498533 .. 29499567
1035 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G013200.1

Sequence Viewer

Length: 207 bp
ATGCCCCAGCCAGCTATGGTCGCAGTTGATAATGGCTCACGCAGGAAAGCCACTTTGATTAAGGTAGATAGTGCAATAAGTGTGGAAGTTTGCTACAAGTGGTTCAGGTTCGGAAATTTGAGTATCATTATAAGAAGGGCTTCCATTTCTGCAGATGGGGATTGGTTCATGGATGGTAAGGTTTTGAGTTCCAATTGCTGTAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.54

Weight (kDa)

9.02

Isoelectric Point (pI)

35.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000515)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G47560 AT3G47560 AT3G47560 AT3G47560 AT3G47560 AT3G47590 AT3G47590
fragaria_vesca FvH4_1g07650 FvH4_1g07670 FvH4_1g07671 FvH4_1g07680 FvH4_1g07690 FvH4_1g07700 FvH4_1g07700
malus_domestica MD02G1080900.v1.1 MD02G1081000.v1.1 MD02G1081300.v1.1 MD02G1081400.v1.1 MD02G1094000.v1.1 MD15G1208700.v1.1
prunus_persica Prupe.7G208200_v2.0.a1 Prupe.7G208200_v2.0.a1
pyrus_communis pycom02g07440 pycom15g18480
rosa_chinensis RchiOBHm_Chr2g0093511 RchiOBHm_Chr2g0093521 RchiOBHm_Chr2g0093531 RchiOBHm_Chr2g0093541 RchiOBHm_Chr2g0093551 RchiOBHm_Chr2g0093561
rosa_laevigata RLG00000016413 RLG00000016414 RLG00000016415 RLG00000016416 RLG00000016417
rosa_multiflora Rmu_sc0004423.1_g000003 Rmu_sc0004423.1_g000004 Rmu_sc0004423.1_g000005 Rmu_sc0004423.1_g000006 Rmu_sc0006964.1_g000003 Rmu_sc0039672.1_g000001 Rmu_sc0039672.1_g000003
rosa_roxburghii Rroxscaffold_2G00147990 Rroxscaffold_2G00148000 Rroxscaffold_2G00148010 Rroxscaffold_2G00148020 Rroxscaffold_4G00313540
rosa_rugosa Rorug01G0140600.1 Rorug01G0140700.1 Rorug02G0037000 Rorug02G0037100 Rorug02G0037200 Rorug02G0037300 Rorug02G0037400 Rorug02G0037500 Rorug02G0037600
rosa_samantha Rh2AG083400 Rh2AG083500 Rh2AG083700 Rh2AG083800 Rh2AG083900 Rh2AG084000 Rh2BG084200 Rh2BG084300 Rh2BG084400 Rh2BG084500 Rh2BG084600 Rh2CG086300 Rh2CG086400 Rh2CG086500 Rh2CG086700 Rh2CG086800 Rh2CG086900 Rh2DG082200 Rh2DG082300 Rh2DG082400 Rh2DG082500 Rh2DG082600 Rh2DG082700
rosa_wichuraiana Rw1G013200 Rw2G006360 Rw2G006370 Rw2G006380 Rw2G006390 Rw2G006400 Rw2G007130

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 131
AcsI RAATTY 1 cut(s) 115
AluBI AGCT 1 cut(s) 14
AluI AGCT 1 cut(s) 14
ApoI RAATTY 1 cut(s) 115
Asp700I GAANNNNTTC 1 cut(s) 139
BccI CCATC 2 cut(s) 149, 167
BfmI CTRYAG 1 cut(s) 150
BseGI GGATG 1 cut(s) 178
BseYI CCCAGC 1 cut(s) 6
BspMAI CTGCAG 1 cut(s) 154
BstC8I GCNNGC 1 cut(s) 12
BstF5I GGATG 1 cut(s) 178
BstMWI GCNNNNNNNGC 1 cut(s) 20
BstSFI CTRYAG 1 cut(s) 150
BtsCI GGATG 1 cut(s) 178
Cac8I GCNNGC 1 cut(s) 12
CspCI CAANNNNNGTGG 2 cut(s) 63, 98
CviAII CATG 1 cut(s) 169
CviJI RGCY 5 cut(s) 10, 14, 36, 50, 140
CviKI_1 RGCY 5 cut(s) 10, 14, 36, 50, 140
FaeI CATG 1 cut(s) 172
FaiI YATR 3 cut(s) 17, 131, 170
FalI AAGNNNNNCTT 2 cut(s) 124, 156
FatI CATG 1 cut(s) 168
FokI GGATG 1 cut(s) 185
GsaI CCCAGC 1 cut(s) 10
Hin1II CATG 1 cut(s) 172
Hpy188I TCNGA 1 cut(s) 113
HpyAV CCTTC 1 cut(s) 129
HpyCH4V TGCA 2 cut(s) 74, 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
Hsp92II CATG 1 cut(s) 172
LpnPI CCDG 4 cut(s) 20, 24, 28, 91
MfeI CAATTG 1 cut(s) 193
MluCI AATT 3 cut(s) 115, 193, 202
MroXI GAANNNNTTC 1 cut(s) 139
MseI TTAA 1 cut(s) 60
MunI CAATTG 1 cut(s) 193
MwoI GCNNNNNNNGC 1 cut(s) 20
NlaIII CATG 1 cut(s) 172
PdmI GAANNNNTTC 1 cut(s) 139
PsiI TTATAA 1 cut(s) 131
PspFI CCCAGC 1 cut(s) 6
PstI CTGCAG 1 cut(s) 154
SaqAI TTAA 1 cut(s) 60
SetI ASST 4 cut(s) 16, 66, 110, 183
SfcI CTRYAG 1 cut(s) 150
SgeI CNNG 7 cut(s) 19, 23, 51, 55, 109, 118, 181
Sse9I AATT 3 cut(s) 115, 193, 202
TasI AATT 3 cut(s) 115, 193, 202
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
TspDTI ATGAA 1 cut(s) 157
XapI RAATTY 1 cut(s) 115
XmnI GAANNNNTTC 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.