FvH4_5g24273

Benzyl alcohol

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0000190
Physical Location & Seq
Reverse (-)
15601255 .. 15601638
384 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g24273.t1

Sequence Viewer

Length: 300 bp
ATGTCGTTGCCATCCTCCCCAGTATTTCAGGTTTATCGAATGCAACCACAACTTGTAACTCCGGCAAGGCCAACTCCTTGTGAAATAAAGATGCTGTCTGATATAGATGACCAGCAAGGCCTTAGGTTTCAGATACCAGCCATCATAGCCTGCAAGAACAATCCTTCGATGCTCAGGGAAGGGCCTAACAGAAAGCTTATGCTGGATTGCAATGGAGAAGGCGTCTTGTTCGTCGAGGCTAAAGCTGACGTCACTCTCGAGCAACTCGGAGATGCTATTCGACCCCCTGCCCTTTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Transferase

Protein Analysis

100

Amino Acids

10.92

Weight (kDa)

5.27

Isoelectric Point (pI)

49.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Transferase PF02458 58 - 93 3.6e-07 Transferase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000190)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G03480 AT5G17540
fragaria_vesca FvH4_2g12510 FvH4_3g38880 FvH4_3g40890 FvH4_5g24240 FvH4_5g24250 FvH4_5g24270 FvH4_5g24273 FvH4_6g05391 FvH4_6g05392
malus_domestica MD00G1201900.v1.1 MD00G1202100.v1.1 MD02G1001400.v1.1 MD02G1013900.v1.1 MD02G1014800.v1.1 MD02G1015000.v1.1 MD02G1015200.v1.1 MD03G1080200.v1.1 MD06G1016200.v1.1 MD06G1016500.v1.1 MD06G1017700.v1.1 MD06G1018100.v1.1 MD06G1018200.v1.1 MD06G1018400.v1.1 MD06G1018700.v1.1 MD06G1018800.v1.1 MD06G1019000.v1.1 MD06G1019100.v1.1 MD06G1019300.v1.1 MD06G1019800.v1.1 MD06G1020400.v1.1 MD06G1020700.v1.1 MD06G1020800.v1.1 MD06G1020900.v1.1 MD12G1038300.v1.1 MD12G1039400.v1.1
prunus_persica Prupe.5G017800_v2.0.a1 Prupe.5G017900_v2.0.a1 Prupe.5G018000_v2.0.a1 Prupe.5G018100_v2.0.a1 Prupe.5G018200_v2.0.a1 Prupe.8G000100_v2.0.a1
pyrus_communis pycom02g01330 pycom02g01390 pycom03g06420 pycom06g01300 pycom06g01320 pycom06g01340 pycom06g01500 pycom06g01510 pycom06g01520 pycom12g03300 pycom12g03320
rosa_chinensis RchiOBHm_Chr5g0051841 RchiOBHm_Chr6g0272991 RchiOBHm_Chr7g0213951 RchiOBHm_Chr7g0214051 RchiOBHm_Chr7g0214131 RchiOBHm_Chr7g0214161 RchiOBHm_Chr7g0214231 RchiOBHm_Chr7g0214321 RchiOBHm_Chr7g0214351 RchiOBHm_Chr7g0214391 RchiOBHm_Chr7g0214451 RchiOBHm_Chr7g0222591
rosa_laevigata RLG00000002044 RLG00000002744 RLG00000002751 RLG00000002752 RLG00000002755 RLG00000002756 RLG00000002757 RLG00000002758 RLG00000002762 RLG00000002763 RLG00000013652
rosa_multiflora Rmu_sc0000328.1_g000008 Rmu_sc0003764.1_g000001 Rmu_sc0003764.1_g000002 Rmu_sc0004199.1_g000004 Rmu_sc0004199.1_g000006 Rmu_sc0004199.1_g000014 Rmu_sc0004199.1_g000019 Rmu_sc0004199.1_g000022 Rmu_sc0005063.1_g000018 Rmu_sc0006422.1_g000030 Rmu_sc0006422.1_g000031 Rmu_sc0009579.1_g000011 Rmu_sc0009579.1_g000017 Rmu_sc0016182.1_g000005 Rmu_sc0016182.1_g000007 Rmu_sc0016279.1_g000002 Rmu_ssc0000387.1_g000031
rosa_roxburghii Rroxscaffold_1G00027390 Rroxscaffold_2G00146810 Rroxscaffold_3G00236600 Rroxscaffold_3G00236620 Rroxscaffold_3G00245350 Rroxscaffold_3G00245400 Rroxscaffold_3G00245440 Rroxscaffold_3G00245480 Rroxscaffold_3G00245560 Rroxscaffold_7G00195770
rosa_rugosa Rorug02G0047800 Rorug02G0047900 Rorug05G0276800 Rorug06G0071900 Rorug07G0145400 Rorug07G0145500 Rorug07G0145600 Rorug07G0145700 Rorug07G0145700 Rorug07G0145800 Rorug07G0211200
rosa_samantha Rh5BG359700 Rh6AG187600 Rh6DG181500 Rh7AG278000 Rh7AG278900 Rh7AG279800 Rh7AG279900 Rh7AG280100 Rh7AG280400 Rh7AG280700 Rh7AG281200 Rh7AG354300 Rh7AG354800 Rh7BG272300 Rh7BG272500 Rh7BG272600 Rh7BG272700 Rh7BG272800 Rh7BG273000 Rh7BG343200 Rh7CG297000 Rh7CG297900 Rh7CG298100 Rh7CG298800 Rh7CG299100 Rh7CG299300 Rh7CG299400 Rh7CG300000 Rh7CG300200 Rh7CG300600 Rh7CG371800 Rh7CG371900
rosa_wichuraiana Rw5G032880 Rw6G016270 Rw7G023930 Rw7G023980 Rw7G023990 Rw7G024000 Rw7G024010 Rw7G024020 Rw7G024030 Rw7G029800 Rw7G030090 Rw7G030140

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 252
AcyI GRCGYC 2 cut(s) 222, 249
AluBI AGCT 2 cut(s) 196, 245
AluI AGCT 2 cut(s) 196, 245
Ama87I CYCGRG 1 cut(s) 257
AoxI GGCC 3 cut(s) 68, 118, 182
AspS9I GGNCC 1 cut(s) 182
AvaI CYCGRG 1 cut(s) 257
AxyI CCTNAGG 1 cut(s) 122
BccI CCATC 2 cut(s) 19, 149
BmeT110I CYCGRG 1 cut(s) 257
BmgT120I GGNCC 1 cut(s) 182
BmrI ACTGGG 1 cut(s) 14
BmsI GCATC 3 cut(s) 81, 159, 262
BmuI ACTGGG 1 cut(s) 14
Bpu10I CCTNAGC 1 cut(s) 173
BsaHI GRCGYC 2 cut(s) 222, 249
BsaXI ACNNNNNCTCC 2 cut(s) 207, 237
Bse1I ACTGG 1 cut(s) 20
Bse21I CCTNAGG 1 cut(s) 122
Bse3DI GCAATG 1 cut(s) 217
BseGI GGATG 1 cut(s) 11
BseMI GCAATG 1 cut(s) 217
BseMII CTCAG 1 cut(s) 187
BseNI ACTGG 1 cut(s) 20
BshFI GGCC 3 cut(s) 70, 120, 184
BsiHKCI CYCGRG 1 cut(s) 257
BsiSI CCGG 1 cut(s) 62
BsmI GAATGC 1 cut(s) 45
BsnI GGCC 3 cut(s) 70, 120, 184
BsoBI CYCGRG 1 cut(s) 257
BspANI GGCC 3 cut(s) 70, 120, 184
BspCNI CTCAG 1 cut(s) 186
BsrDI GCAATG 1 cut(s) 217
BsrI ACTGG 1 cut(s) 20
BssNI GRCGYC 2 cut(s) 222, 249
BstACI GRCGYC 2 cut(s) 222, 249
BstC8I GCNNGC 1 cut(s) 151
BstDEI CTNAG 3 cut(s) 122, 173, 297
BstF5I GGATG 1 cut(s) 11
BstMWI GCNNNNNNNGC 1 cut(s) 146
Bsu36I CCTNAGG 1 cut(s) 122
BsuRI GGCC 3 cut(s) 70, 120, 184
BtsCI GGATG 1 cut(s) 11
Cac8I GCNNGC 1 cut(s) 151
Cfr13I GGNCC 1 cut(s) 182
CseI GACGC 1 cut(s) 211
CviJI RGCY 8 cut(s) 70, 120, 140, 149, 184, 196, 239, 245
CviKI_1 RGCY 8 cut(s) 70, 120, 140, 149, 184, 196, 239, 245
DdeI CTNAG 3 cut(s) 122, 173, 297
Eco147I AGGCCT 1 cut(s) 120
Eco81I CCTNAGG 1 cut(s) 122
Eco88I CYCGRG 1 cut(s) 257
EcoO109I RGGNCCY 1 cut(s) 182
FaiI YATR 3 cut(s) 104, 146, 200
HaeIII GGCC 3 cut(s) 70, 120, 184
HapII CCGG 1 cut(s) 62
HgaI GACGC 1 cut(s) 211
Hin1I GRCGYC 2 cut(s) 222, 249
HindIII AAGCTT 1 cut(s) 194
HpaII CCGG 1 cut(s) 62
Hpy188I TCNGA 3 cut(s) 100, 132, 269
Hpy188III TCNNGA 1 cut(s) 257
Hpy99I CGWCG 1 cut(s) 236
HpyAV CCTTC 3 cut(s) 173, 174, 212
HpyCH4IV ACGT 1 cut(s) 249
HpyCH4V TGCA 3 cut(s) 43, 153, 210
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
HpyF3I CTNAG 3 cut(s) 122, 173, 297
HpySE526I ACGT 1 cut(s) 249
Hsp92I GRCGYC 2 cut(s) 222, 249
LpnPI CCDG 8 cut(s) 14, 33, 75, 125, 150, 160, 163, 188
LweI GCATC 3 cut(s) 81, 159, 262
MaeII ACGT 1 cut(s) 249
MaeIII GTNAC 2 cut(s) 55, 250
MnlI CCTC 2 cut(s) 25, 229
MspI CCGG 1 cut(s) 62
Mva1269I GAATGC 1 cut(s) 45
MwoI GCNNNNNNNGC 1 cut(s) 146
NmuCI GTSAC 1 cut(s) 250
PaeR7I CTCGAG 1 cut(s) 257
PceI AGGCCT 1 cut(s) 120
PcsI WCGNNNNNNNCGW 1 cut(s) 255
PctI GAATGC 1 cut(s) 45
PspPI GGNCC 1 cut(s) 182
Sau96I GGNCC 1 cut(s) 182
SetI ASST 5 cut(s) 33, 128, 198, 247, 252
SfaNI GCATC 3 cut(s) 81, 159, 262
Sfr274I CTCGAG 1 cut(s) 257
SlaI CTCGAG 1 cut(s) 257
SmlI CTYRAG 1 cut(s) 257
SmoI CTYRAG 1 cut(s) 257
SseBI AGGCCT 1 cut(s) 120
StuI AGGCCT 1 cut(s) 120
TaiI ACGT 1 cut(s) 252
TaqI TCGA 5 cut(s) 37, 167, 234, 258, 280
TseFI GTSAC 1 cut(s) 250
Tsp45I GTSAC 1 cut(s) 250
XhoI CTCGAG 1 cut(s) 257
ZraI GACGTC 1 cut(s) 250
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.