MD03G1059800.v1.1

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
Physical Location & Seq
Forward (+)
4831328 .. 4832444
1117 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1059800.v1.1.491

Sequence Viewer

Length: 291 bp
ATGAGCAAGGTGGTGACAACGAAGTTGCAAATTCTTAATACTCCTGATGATGCACCTATTGGTACTTTTAGATTTCATTTTGACAATGGTTTTTTAAAGTACAACAATAGAATTGTGCTAAGCCCTTGTAGTGCTTGGAAGGATAAGGTCTTTATTGAACATCACTCAAGCCATGTTGCTGGACATGAGAGGTTTCTAAAAACCTACAAGAGAATATCGAGATCATTCTATTGGGAAGGCATGAAGAAGGATATCAAGGACAGAGTTACTACTTGTGCCATTTGCCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

97

Amino Acids

11.25

Weight (kDa)

9.58

Isoelectric Point (pI)

30.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Integrase_H2C2 PF17921 47 - 96 2.9e-16 Integrase zinc binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 30
AfaI GTAC 2 cut(s) 64, 101
AgsI TTSAA 1 cut(s) 158
ApoI RAATTY 1 cut(s) 30
AsuHPI GGTGA 1 cut(s) 25
BlpI GCTNAGC 1 cut(s) 119
BmsI GCATC 1 cut(s) 40
Bpu1102I GCTNAGC 1 cut(s) 119
BpuEI CTTGAG 1 cut(s) 151
Bsp143I GATC 1 cut(s) 221
Bsp1720I GCTNAGC 1 cut(s) 119
BssMI GATC 1 cut(s) 221
BstDEI CTNAG 1 cut(s) 119
BstKTI GATC 1 cut(s) 224
BstMBI GATC 1 cut(s) 221
BstXI CCANNNNNNTGG 1 cut(s) 179
Csp6I GTAC 2 cut(s) 63, 100
CviAII CATG 3 cut(s) 173, 185, 241
CviJI RGCY 2 cut(s) 123, 171
CviKI_1 RGCY 2 cut(s) 123, 171
CviQI GTAC 2 cut(s) 63, 100
DdeI CTNAG 1 cut(s) 119
DpnI GATC 1 cut(s) 223
DpnII GATC 1 cut(s) 221
DraI TTTAAA 1 cut(s) 96
Eco32I GATATC 1 cut(s) 253
EcoRV GATATC 1 cut(s) 253
FaeI CATG 3 cut(s) 176, 188, 244
FaiI YATR 3 cut(s) 174, 186, 242
FatI CATG 3 cut(s) 172, 184, 240
Hin1II CATG 3 cut(s) 176, 188, 244
HphI GGTGA 1 cut(s) 25
Hpy188III TCNNGA 2 cut(s) 44, 219
HpyAV CCTTC 3 cut(s) 133, 230, 241
HpyCH4V TGCA 2 cut(s) 28, 53
HpyF3I CTNAG 1 cut(s) 119
Hsp92II CATG 3 cut(s) 176, 188, 244
Kzo9I GATC 1 cut(s) 221
LpnPI CCDG 2 cut(s) 57, 165
LweI GCATC 1 cut(s) 40
MaeIII GTNAC 2 cut(s) 13, 265
MalI GATC 1 cut(s) 223
MboI GATC 1 cut(s) 221
MboII GAAGA 1 cut(s) 256
MluCI AATT 2 cut(s) 30, 111
MnlI CCTC 1 cut(s) 183
MseI TTAA 2 cut(s) 36, 95
NdeII GATC 1 cut(s) 221
NlaIII CATG 3 cut(s) 176, 188, 244
NmuCI GTSAC 1 cut(s) 13
RsaI GTAC 2 cut(s) 64, 101
RsaNI GTAC 2 cut(s) 63, 100
SaqAI TTAA 2 cut(s) 36, 95
Sau3AI GATC 1 cut(s) 221
SetI ASST 5 cut(s) 12, 58, 150, 194, 206
SfaNI GCATC 1 cut(s) 40
SmlI CTYRAG 1 cut(s) 166
SmoI CTYRAG 1 cut(s) 166
Sse9I AATT 2 cut(s) 30, 111
TaqI TCGA 1 cut(s) 218
TasI AATT 2 cut(s) 30, 111
TatI WGTACW 1 cut(s) 99
Tru1I TTAA 2 cut(s) 36, 95
Tru9I TTAA 2 cut(s) 36, 95
TseFI GTSAC 1 cut(s) 13
Tsp45I GTSAC 1 cut(s) 13
TspDTI ATGAA 2 cut(s) 65, 257
XapI RAATTY 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.