Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr11

Orthogroup ID

OG0000299

Physical Location & Seq

Genomic Coordinates Reverse (-)

2372922 .. 2373179

Gene Structure 258 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD11G1026800.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 258 bp

ATGCTCTTTGGAATCATGGCTTTCGTAATACCACATGCTTTATGCTTTCTACTCATCCTTATACATCTTCCATTTTTCACCACTTCTCAAGCTTACCAGAATATAACTTTAGGCTCATCCCTCACTGCTCTGGATGACAACACCTTCTGGCCCTCGCCGTCTGGGGAATTTGCTTTCGGTTTCCAAAAAAATGGTAACGGCGGTGGCTTCTTACTAGCCATCTGGTTTGATAAAATACCCGAAAAAACCATTGTCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005488 GO:0005515 GO:0005516 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

B_lectin Pkinase

Protein Analysis

86

Amino Acids

9.4

Weight (kDa)

5.34

Isoelectric Point (pI)

35.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000299)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g43401 FvH4_3g43402 FvH4_3g43403 FvH4_3g43440 FvH4_3g43710 FvH4_3g43772
malus_domestica	MD03G1021800.v1.1 MD03G1022000.v1.1 MD11G1024500.v1.1 MD11G1024700.v1.1 MD11G1025200.v1.1 MD11G1025500.v1.1 MD11G1025600.v1.1 MD11G1026200.v1.1 MD11G1026400.v1.1 MD11G1026500.v1.1 MD11G1026600.v1.1 MD11G1026800.v1.1 MD11G1027300.v1.1
prunus_persica	Prupe.6G020400_v2.0.a1 Prupe.6G020500_v2.0.a1 Prupe.6G020600_v2.0.a1 Prupe.6G020700_v2.0.a1 Prupe.6G020800_v2.0.a1 Prupe.6G020900_v2.0.a1 Prupe.6G021000_v2.0.a1 Prupe.6G021500_v2.0.a1 Prupe.6G021600_v2.0.a1
pyrus_communis	pycom03g01850 pycom03g01870 pycom03g01900 pycom03g01910 pycom11g01950 pycom11g01980 pycom11g01990 pycom11g02030 pycom11g02040
rosa_chinensis	RchiOBHm_Chr5g0077411 RchiOBHm_Chr5g0077421 RchiOBHm_Chr5g0077571 RchiOBHm_Chr5g0077601 RchiOBHm_Chr5g0077621 RchiOBHm_Chr5g0077651 RchiOBHm_Chr5g0077661 RchiOBHm_Chr5g0077671 RchiOBHm_Chr5g0077701 RchiOBHm_Chr5g0077741 RchiOBHm_Chr5g0077791 RchiOBHm_Chr5g0077861 RchiOBHm_Chr5g0078871 RchiOBHm_Chr5g0078901 RchiOBHm_Chr5g0078941 RchiOBHm_Chr5g0079081 RchiOBHm_Chr5g0079091 RchiOBHm_Chr7g0233481
rosa_laevigata	RLG00000036694 RLG00000036704 RLG00000036705 RLG00000036710 RLG00000036713 RLG00000036714 RLG00000036716 RLG00000036793 RLG00000036796 RLG00000036804 RLG00000036806
rosa_multiflora	Rmu_co8130992.1_g000001 Rmu_sc0000029.1_g000037 Rmu_sc0002187.1_g000023 Rmu_sc0004168.1_g000001 Rmu_sc0004168.1_g000004 Rmu_sc0004168.1_g000018 Rmu_sc0004168.1_g000028 Rmu_sc0004168.1_g000033 Rmu_sc0004168.1_g000056 Rmu_sc0004277.1_g000009 Rmu_sc0004277.1_g000016 Rmu_sc0004277.1_g000018 Rmu_sc0004277.1_g000020 Rmu_sc0004277.1_g000084 Rmu_sc0004277.1_g000087 Rmu_sc0012487.1_g000001 Rmu_sc0012487.1_g000002
rosa_roxburghii	Rroxscaffold_1G00003760 Rroxscaffold_1G00003780 Rroxscaffold_1G00004370 Rroxscaffold_1G00004400 Rroxscaffold_1G00004490 Rroxscaffold_1G00004510 Rroxscaffold_3G00227260 Rroxscaffold_5G00366480
rosa_rugosa	Rorug05G0454800 Rorug05G0455700 Rorug05G0455900 Rorug05G0456100 Rorug05G0456300 Rorug05G0456700.1 Rorug05G0461800 Rorug05G0462100 Rorug07G0280900.1 Rorug07G0281000
rosa_samantha	Rh5CG562200 Rh5DG543500 Rh5DG544200 Rh5DG544400 Rh5DG544500 Rh5DG544600 Rh5DG544700 Rh5DG544900 Rh5DG545200 Rh5DG549700 Rh7DG426000
rosa_wichuraiana	Rw0G003130 Rw0G023780 Rw0G023790 Rw5G046780 Rw5G047330 Rw5G047350 Rw5G047370 Rw5G047390 Rw5G047420 Rw7G036050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	201
AcsI	RAATTY	1 cut(s)	167
AluBI	AGCT	1 cut(s)	92
AluI	AGCT	1 cut(s)	92
AoxI	GGCC	1 cut(s)	149
ApoI	RAATTY	1 cut(s)	167
AspS9I	GGNCC	1 cut(s)	150
AsuHPI	GGTGA	1 cut(s)	70
BccI	CCATC	1 cut(s)	227
BceAI	ACGGC	2 cut(s)	142, 214
BfaI	CTAG	1 cut(s)	215
BmgT120I	GGNCC	1 cut(s)	150
BpuEI	CTTGAG	1 cut(s)	72
BseGI	GGATG	3 cut(s)	54, 116, 139
BshFI	GGCC	1 cut(s)	151
BsnI	GGCC	1 cut(s)	151
BspACI	CCGC	1 cut(s)	201
BspANI	GGCC	1 cut(s)	151
BstF5I	GGATG	3 cut(s)	54, 116, 139
BstNSI	RCATGY	1 cut(s)	38
BstXI	CCANNNNNNTGG	1 cut(s)	191
BsuRI	GGCC	1 cut(s)	151
BtsCI	GGATG	3 cut(s)	54, 116, 139
BtsI	GCAGTG	1 cut(s)	123
BtsIMutI	CAGTG	1 cut(s)	123
Cfr13I	GGNCC	1 cut(s)	150
CviAII	CATG	2 cut(s)	16, 35
CviJI	RGCY	6 cut(s)	20, 92, 114, 151, 207, 218
CviKI_1	RGCY	6 cut(s)	20, 92, 114, 151, 207, 218
FaeI	CATG	2 cut(s)	19, 38
FaiI	YATR	5 cut(s)	17, 36, 43, 62, 104
FatI	CATG	2 cut(s)	15, 34
FokI	GGATG	3 cut(s)	41, 103, 146
FspBI	CTAG	1 cut(s)	215
HaeIII	GGCC	1 cut(s)	151
Hin1II	CATG	2 cut(s)	19, 38
HindIII	AAGCTT	1 cut(s)	90
HinfI	GANTC	1 cut(s)	12
HphI	GGTGA	1 cut(s)	70
Hpy188III	TCNNGA	1 cut(s)	131
HpyAV	CCTTC	1 cut(s)	154
Hsp92II	CATG	2 cut(s)	19, 38
LpnPI	CCDG	5 cut(s)	110, 116, 133, 147, 208
MaeI	CTAG	1 cut(s)	215
MaeIII	GTNAC	1 cut(s)	194
MboII	GAAGA	1 cut(s)	59
MluCI	AATT	1 cut(s)	167
MnlI	CCTC	2 cut(s)	131, 163
NlaIII	CATG	2 cut(s)	19, 38
NspI	RCATGY	1 cut(s)	38
PfeI	GAWTC	1 cut(s)	12
PspPI	GGNCC	1 cut(s)	150
Sau96I	GGNCC	1 cut(s)	150
SetI	ASST	2 cut(s)	94, 146
SmlI	CTYRAG	1 cut(s)	87
SmoI	CTYRAG	1 cut(s)	87
Sse9I	AATT	1 cut(s)	167
SsiI	CCGC	1 cut(s)	201
SspMI	CTAG	1 cut(s)	215
TasI	AATT	1 cut(s)	167
TfiI	GAWTC	1 cut(s)	12
TscAI	CASTG	1 cut(s)	130
TspRI	CASTG	1 cut(s)	130
XapI	RAATTY	1 cut(s)	167
XceI	RCATGY	1 cut(s)	38
XspI	CTAG	1 cut(s)	215

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.