Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8130992.1

Orthogroup ID

OG0000299

Physical Location & Seq

Genomic Coordinates Reverse (-)

116 .. 466

Gene Structure 351 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8130992.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 351 bp

atggcttttgaaataccttattctttatgctttctgtttgtcctgctacagcttcccttttccaccattgctcaaagttacaataatatatcttttggctcttaccttactgcacaggaggataacctttcctgggcctcaccgtctggggagtttgcgttcggcttccaaaaagttggcaatgccggcttcttactagccatctggtttgacaaaatacctgaaaggactatagtctggtcagccaatcgcaataatccagtgcaacaaggatcgagagttgaattctctgcagaaggcaagcttactctcactgatattggaacaggcaaaccaacaaacattgcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005488 GO:0005515 GO:0005516 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

B_lectin Pkinase

Protein Analysis

116

Amino Acids

12.82

Weight (kDa)

4.89

Isoelectric Point (pI)

34.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000299)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g43401 FvH4_3g43402 FvH4_3g43403 FvH4_3g43440 FvH4_3g43710 FvH4_3g43772
malus_domestica	MD03G1021800.v1.1 MD03G1022000.v1.1 MD11G1024500.v1.1 MD11G1024700.v1.1 MD11G1025200.v1.1 MD11G1025500.v1.1 MD11G1025600.v1.1 MD11G1026200.v1.1 MD11G1026400.v1.1 MD11G1026500.v1.1 MD11G1026600.v1.1 MD11G1026800.v1.1 MD11G1027300.v1.1
prunus_persica	Prupe.6G020400_v2.0.a1 Prupe.6G020500_v2.0.a1 Prupe.6G020600_v2.0.a1 Prupe.6G020700_v2.0.a1 Prupe.6G020800_v2.0.a1 Prupe.6G020900_v2.0.a1 Prupe.6G021000_v2.0.a1 Prupe.6G021500_v2.0.a1 Prupe.6G021600_v2.0.a1
pyrus_communis	pycom03g01850 pycom03g01870 pycom03g01900 pycom03g01910 pycom11g01950 pycom11g01980 pycom11g01990 pycom11g02030 pycom11g02040
rosa_chinensis	RchiOBHm_Chr5g0077411 RchiOBHm_Chr5g0077421 RchiOBHm_Chr5g0077571 RchiOBHm_Chr5g0077601 RchiOBHm_Chr5g0077621 RchiOBHm_Chr5g0077651 RchiOBHm_Chr5g0077661 RchiOBHm_Chr5g0077671 RchiOBHm_Chr5g0077701 RchiOBHm_Chr5g0077741 RchiOBHm_Chr5g0077791 RchiOBHm_Chr5g0077861 RchiOBHm_Chr5g0078871 RchiOBHm_Chr5g0078901 RchiOBHm_Chr5g0078941 RchiOBHm_Chr5g0079081 RchiOBHm_Chr5g0079091 RchiOBHm_Chr7g0233481
rosa_laevigata	RLG00000036694 RLG00000036704 RLG00000036705 RLG00000036710 RLG00000036713 RLG00000036714 RLG00000036716 RLG00000036793 RLG00000036796 RLG00000036804 RLG00000036806
rosa_multiflora	Rmu_co8130992.1_g000001 Rmu_sc0000029.1_g000037 Rmu_sc0002187.1_g000023 Rmu_sc0004168.1_g000001 Rmu_sc0004168.1_g000004 Rmu_sc0004168.1_g000018 Rmu_sc0004168.1_g000028 Rmu_sc0004168.1_g000033 Rmu_sc0004168.1_g000056 Rmu_sc0004277.1_g000009 Rmu_sc0004277.1_g000016 Rmu_sc0004277.1_g000018 Rmu_sc0004277.1_g000020 Rmu_sc0004277.1_g000084 Rmu_sc0004277.1_g000087 Rmu_sc0012487.1_g000001 Rmu_sc0012487.1_g000002
rosa_roxburghii	Rroxscaffold_1G00003760 Rroxscaffold_1G00003780 Rroxscaffold_1G00004370 Rroxscaffold_1G00004400 Rroxscaffold_1G00004490 Rroxscaffold_1G00004510 Rroxscaffold_3G00227260 Rroxscaffold_5G00366480
rosa_rugosa	Rorug05G0454800 Rorug05G0455700 Rorug05G0455900 Rorug05G0456100 Rorug05G0456300 Rorug05G0456700.1 Rorug05G0461800 Rorug05G0462100 Rorug07G0280900.1 Rorug07G0281000
rosa_samantha	Rh5CG562200 Rh5DG543500 Rh5DG544200 Rh5DG544400 Rh5DG544500 Rh5DG544600 Rh5DG544700 Rh5DG544900 Rh5DG545200 Rh5DG549700 Rh7DG426000
rosa_wichuraiana	Rw0G003130 Rw0G023780 Rw0G023790 Rw5G046780 Rw5G047330 Rw5G047350 Rw5G047370 Rw5G047390 Rw5G047420 Rw7G036050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	280
AcsI	RAATTY	1 cut(s)	284
AfiI	CCNNNNNNNGG	1 cut(s)	133
AgsI	TTSAA	2 cut(s)	11, 284
AjnI	CCWGG	1 cut(s)	131
AloI	GAACNNNNNNTCC	2 cut(s)	143, 175
AluBI	AGCT	2 cut(s)	52, 304
AluI	AGCT	2 cut(s)	52, 304
AlwI	GGATC	1 cut(s)	280
AoxI	GGCC	1 cut(s)	135
ApoI	RAATTY	1 cut(s)	284
AspS9I	GGNCC	1 cut(s)	135
AsuHPI	GGTGA	1 cut(s)	132
BccI	CCATC	1 cut(s)	209
BciT130I	CCWGG	1 cut(s)	133
BfaI	CTAG	1 cut(s)	197
BfmI	CTRYAG	3 cut(s)	47, 231, 291
Bme1390I	CCNGG	1 cut(s)	133
BmgT120I	GGNCC	1 cut(s)	135
BmrFI	CCNGG	1 cut(s)	133
BoxI	GACNNNNGTC	1 cut(s)	233
BsaJI	CCNNGG	1 cut(s)	132
BsaXI	ACNNNNNCTCC	2 cut(s)	143, 173
Bsc4I	CCNNNNNNNGG	1 cut(s)	133
Bse118I	RCCGGY	1 cut(s)	185
Bse1I	ACTGG	1 cut(s)	260
Bse3DI	GCAATG	3 cut(s)	66, 187, 342
BseBI	CCWGG	1 cut(s)	133
BseDI	CCNNGG	1 cut(s)	132
BseLI	CCNNNNNNNGG	1 cut(s)	133
BseMI	GCAATG	3 cut(s)	66, 187, 342
BseNI	ACTGG	1 cut(s)	260
BsgI	GTGCAG	1 cut(s)	96
BshFI	GGCC	1 cut(s)	137
BsiSI	CCGG	1 cut(s)	186
BslI	CCNNNNNNNGG	1 cut(s)	133
BsnI	GGCC	1 cut(s)	137
Bsp143I	GATC	1 cut(s)	272
BspANI	GGCC	1 cut(s)	137
BspMAI	CTGCAG	1 cut(s)	295
BspPI	GGATC	1 cut(s)	280
BsrDI	GCAATG	3 cut(s)	66, 187, 342
BsrFI	RCCGGY	1 cut(s)	185
BsrI	ACTGG	1 cut(s)	260
BssAI	RCCGGY	1 cut(s)	185
BssECI	CCNNGG	1 cut(s)	132
BssMI	GATC	1 cut(s)	272
Bst2UI	CCWGG	1 cut(s)	133
Bst4CI	ACNGT	1 cut(s)	144
BstC8I	GCNNGC	2 cut(s)	187, 302
BstKTI	GATC	1 cut(s)	275
BstMBI	GATC	1 cut(s)	272
BstMWI	GCNNNNNNNGC	1 cut(s)	186
BstNI	CCWGG	1 cut(s)	133
BstPAI	GACNNNNGTC	1 cut(s)	233
BstSCI	CCNGG	1 cut(s)	131
BstSFI	CTRYAG	3 cut(s)	47, 231, 291
BstXI	CCANNNNNNTGG	1 cut(s)	176
BsuRI	GGCC	1 cut(s)	137
BtsIMutI	CAGTG	2 cut(s)	267, 312
Cac8I	GCNNGC	2 cut(s)	187, 302
Cfr10I	RCCGGY	1 cut(s)	185
Cfr13I	GGNCC	1 cut(s)	135
CviAII	CATG	1 cut(s)	348
CviJI	RGCY	9 cut(s)	5, 52, 99, 137, 165, 189, 200, 245, 304
CviKI_1	RGCY	9 cut(s)	5, 52, 99, 137, 165, 189, 200, 245, 304
DpnI	GATC	1 cut(s)	274
DpnII	GATC	1 cut(s)	272
EcoRI	GAATTC	1 cut(s)	284
EcoRII	CCWGG	1 cut(s)	131
FaeI	CATG	1 cut(s)	351
FaiI	YATR	4 cut(s)	28, 89, 233, 349
FalI	AAGNNNNNCTT	2 cut(s)	288, 320
FatI	CATG	1 cut(s)	347
FspBI	CTAG	1 cut(s)	197
HaeIII	GGCC	1 cut(s)	137
HapII	CCGG	1 cut(s)	186
Hin1II	CATG	1 cut(s)	351
HindIII	AAGCTT	1 cut(s)	302
HpaII	CCGG	1 cut(s)	186
HphI	GGTGA	1 cut(s)	132
Hpy188III	TCNNGA	1 cut(s)	276
HpyAV	CCTTC	1 cut(s)	290
HpyCH4III	ACNGT	1 cut(s)	144
HpyCH4V	TGCA	4 cut(s)	113, 265, 293, 347
HpyF10VI	GCNNNNNNNGC	1 cut(s)	186
Hsp92II	CATG	1 cut(s)	351
KroI	GCCGGC	1 cut(s)	185
KroNI	GCCGGC	1 cut(s)	187
Kzo9I	GATC	1 cut(s)	272
MaeI	CTAG	1 cut(s)	197
MaeIII	GTNAC	1 cut(s)	77
MalI	GATC	1 cut(s)	274
MboI	GATC	1 cut(s)	272
MluCI	AATT	1 cut(s)	284
MnlI	CCTC	2 cut(s)	112, 148
MroNI	GCCGGC	1 cut(s)	185
MspI	CCGG	1 cut(s)	186
MspR9I	CCNGG	1 cut(s)	133
MvaI	CCWGG	1 cut(s)	133
MwoI	GCNNNNNNNGC	1 cut(s)	186
NaeI	GCCGGC	1 cut(s)	187
NdeII	GATC	1 cut(s)	272
NgoMIV	GCCGGC	1 cut(s)	185
NlaIII	CATG	1 cut(s)	351
PdiI	GCCGGC	1 cut(s)	187
PshAI	GACNNNNGTC	1 cut(s)	233
Psp6I	CCWGG	1 cut(s)	131
PspGI	CCWGG	1 cut(s)	131
PspPI	GGNCC	1 cut(s)	135
PstI	CTGCAG	1 cut(s)	295
Sau3AI	GATC	1 cut(s)	272
Sau96I	GGNCC	1 cut(s)	135
ScrFI	CCNGG	1 cut(s)	133
SetI	ASST	6 cut(s)	19, 54, 108, 129, 223, 306
SfcI	CTRYAG	3 cut(s)	47, 231, 291
Sse9I	AATT	1 cut(s)	284
SspMI	CTAG	1 cut(s)	197
StyD4I	CCNGG	1 cut(s)	131
TaaI	ACNGT	1 cut(s)	144
TaqI	TCGA	1 cut(s)	275
TasI	AATT	1 cut(s)	284
TscAI	CASTG	2 cut(s)	267, 319
TspRI	CASTG	2 cut(s)	267, 319
XapI	RAATTY	1 cut(s)	284
XspI	CTAG	1 cut(s)	197

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.