Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004168.1

Orthogroup ID

OG0000299

Physical Location & Seq

Genomic Coordinates Forward (+)

57733 .. 58966

Gene Structure 1234 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004168.1_g000018.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1131 bp

atggctcaaacgtcgaaaatcatatctttaggctcatccctcacagcacaaaacgactataactcctcctggccatccccatctatctgggacagccttgtgccacaaggatcaaaagttgagctcaccagtggtggccgatttgtgctcaatgatgcaaagggcagtcaaatatggtctgccgattcttctagtaccggagtttcctatgcagctatgctcgacaccggaaattttgtgctggctaaccgaaactccacctacttgtgggagagttttgatcacccaactgacacaatgcttcccacacagagtctacaacaaagtggcaaactctttgctcgctacacggtggcaaattactcgacaggtagattcatgttttcactacaacctgatggaaatctcgtgctttacacaacaaatttccctcaagattctcccaatttcgcatattggtccgtcaatactgaaattggatttcaagtcatcttcaatcagtctggccttatttacctaacatccgagaatgggaccatactgcatacaatatcaggcaaccccattgcaacgcagcatttctaccagcgagcaacactcgactatgatggagttttgaggcactatgtttatcctaaaagcagcagctcaagcgaggaaaggtggtcgacttcctctttcataccgccaaatatctgcaggtcaattaccgcagaggtaggaggcggtgcgtgtggtttcaacggcttgtgtaggcttgatgatctaggacgaccaacttgtcaatgtccaaatggttacagttttattgatccaaatgataagctcaaaggatgcaaacaggactttgttccacaaagctgcaacgctggagatgcctcatcaccggctaatgattttgactttgaagagatgcaaaacactaatatgcctggtgatgattatgagcatttccaaggggtggctgaggattggtgcagacagaattgcctagaggattgcttttgtgctgttgccattttcaataacgccggggactgttttaagaagggactccctttttcgaatgggatgattgatcctagtcttattgggacgaaagctcttctcaaaataaggaaagtgttgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005488 GO:0005515 GO:0005516 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

B_lectin Pkinase S_locus_glycop

Protein Analysis

376

Amino Acids

41.35

Weight (kDa)

4.82

Isoelectric Point (pI)

43.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000299)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g43401 FvH4_3g43402 FvH4_3g43403 FvH4_3g43440 FvH4_3g43710 FvH4_3g43772
malus_domestica	MD03G1021800.v1.1 MD03G1022000.v1.1 MD11G1024500.v1.1 MD11G1024700.v1.1 MD11G1025200.v1.1 MD11G1025500.v1.1 MD11G1025600.v1.1 MD11G1026200.v1.1 MD11G1026400.v1.1 MD11G1026500.v1.1 MD11G1026600.v1.1 MD11G1026800.v1.1 MD11G1027300.v1.1
prunus_persica	Prupe.6G020400_v2.0.a1 Prupe.6G020500_v2.0.a1 Prupe.6G020600_v2.0.a1 Prupe.6G020700_v2.0.a1 Prupe.6G020800_v2.0.a1 Prupe.6G020900_v2.0.a1 Prupe.6G021000_v2.0.a1 Prupe.6G021500_v2.0.a1 Prupe.6G021600_v2.0.a1
pyrus_communis	pycom03g01850 pycom03g01870 pycom03g01900 pycom03g01910 pycom11g01950 pycom11g01980 pycom11g01990 pycom11g02030 pycom11g02040
rosa_chinensis	RchiOBHm_Chr5g0077411 RchiOBHm_Chr5g0077421 RchiOBHm_Chr5g0077571 RchiOBHm_Chr5g0077601 RchiOBHm_Chr5g0077621 RchiOBHm_Chr5g0077651 RchiOBHm_Chr5g0077661 RchiOBHm_Chr5g0077671 RchiOBHm_Chr5g0077701 RchiOBHm_Chr5g0077741 RchiOBHm_Chr5g0077791 RchiOBHm_Chr5g0077861 RchiOBHm_Chr5g0078871 RchiOBHm_Chr5g0078901 RchiOBHm_Chr5g0078941 RchiOBHm_Chr5g0079081 RchiOBHm_Chr5g0079091 RchiOBHm_Chr7g0233481
rosa_laevigata	RLG00000036694 RLG00000036704 RLG00000036705 RLG00000036710 RLG00000036713 RLG00000036714 RLG00000036716 RLG00000036793 RLG00000036796 RLG00000036804 RLG00000036806
rosa_multiflora	Rmu_co8130992.1_g000001 Rmu_sc0000029.1_g000037 Rmu_sc0002187.1_g000023 Rmu_sc0004168.1_g000001 Rmu_sc0004168.1_g000004 Rmu_sc0004168.1_g000018 Rmu_sc0004168.1_g000028 Rmu_sc0004168.1_g000033 Rmu_sc0004168.1_g000056 Rmu_sc0004277.1_g000009 Rmu_sc0004277.1_g000016 Rmu_sc0004277.1_g000018 Rmu_sc0004277.1_g000020 Rmu_sc0004277.1_g000084 Rmu_sc0004277.1_g000087 Rmu_sc0012487.1_g000001 Rmu_sc0012487.1_g000002
rosa_roxburghii	Rroxscaffold_1G00003760 Rroxscaffold_1G00003780 Rroxscaffold_1G00004370 Rroxscaffold_1G00004400 Rroxscaffold_1G00004490 Rroxscaffold_1G00004510 Rroxscaffold_3G00227260 Rroxscaffold_5G00366480
rosa_rugosa	Rorug05G0454800 Rorug05G0455700 Rorug05G0455900 Rorug05G0456100 Rorug05G0456300 Rorug05G0456700.1 Rorug05G0461800 Rorug05G0462100 Rorug07G0280900.1 Rorug07G0281000
rosa_samantha	Rh5CG562200 Rh5DG543500 Rh5DG544200 Rh5DG544400 Rh5DG544500 Rh5DG544600 Rh5DG544700 Rh5DG544900 Rh5DG545200 Rh5DG549700 Rh7DG426000
rosa_wichuraiana	Rw0G003130 Rw0G023780 Rw0G023790 Rw5G046780 Rw5G047330 Rw5G047350 Rw5G047370 Rw5G047390 Rw5G047420 Rw7G036050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	780
Acc36I	ACCTGC	1 cut(s)	690
AccB7I	CCANNNNNTGG	1 cut(s)	961
AccI	GTMKAC	2 cut(s)	316, 668
AciI	CCGC	3 cut(s)	686, 711, 726
AclWI	GGATC	3 cut(s)	118, 806, 1073
AcoI	YGGCCR	2 cut(s)	71, 136
AcsI	RAATTY	2 cut(s)	232, 424
AfaI	GTAC	1 cut(s)	196
AfiI	CCNNNNNNNGG	3 cut(s)	267, 531, 961
AgsI	TTSAA	5 cut(s)	485, 496, 742, 908, 1024
AjnI	CCWGG	2 cut(s)	68, 931
AluBI	AGCT	6 cut(s)	124, 215, 648, 826, 861, 1103
AluI	AGCT	6 cut(s)	124, 215, 648, 826, 861, 1103
Alw21I	GWGCWC	2 cut(s)	126, 150
AlwI	GGATC	3 cut(s)	118, 806, 1073
AoxI	GGCC	3 cut(s)	71, 136, 505
ApeKI	GCWGC	5 cut(s)	212, 574, 642, 645, 861
ApoI	RAATTY	2 cut(s)	232, 424
AspS9I	GGNCC	2 cut(s)	459, 534
AsuC2I	CCSGG	1 cut(s)	1033
AsuHPI	GGTGA	4 cut(s)	118, 275, 876, 947
AsuII	TTCGAA	1 cut(s)	1064
AvaII	GGWCC	2 cut(s)	459, 534
BalI	TGGCCA	1 cut(s)	73
BanII	GRGCYC	1 cut(s)	126
BauI	CACGAG	1 cut(s)	407
Bbv12I	GWGCWC	2 cut(s)	126, 150
BbvCI	CCTCAGC	1 cut(s)	966
BbvI	GCAGC	5 cut(s)	224, 586, 654, 657, 848
BccI	CCATC	4 cut(s)	82, 88, 392, 602
BceAI	ACGGC	1 cut(s)	760
BcgI	CGANNNNNNTGC	2 cut(s)	345, 379
BciT130I	CCWGG	2 cut(s)	70, 933
BclI	TGATCA	1 cut(s)	280
BcnI	CCSGG	1 cut(s)	1033
BfaI	CTAG	4 cut(s)	192, 767, 992, 1083
BfmI	CTRYAG	1 cut(s)	697
BfuAI	ACCTGC	1 cut(s)	690
BisI	GCNGC	5 cut(s)	213, 575, 643, 646, 862
BlsI	GCNGC	5 cut(s)	214, 576, 644, 647, 863
Bme1390I	CCNGG	3 cut(s)	70, 933, 1033
Bme18I	GGWCC	2 cut(s)	459, 534
BmgT120I	GGNCC	2 cut(s)	459, 534
BmiI	GGNNCC	1 cut(s)	535
BmrFI	CCNGG	3 cut(s)	70, 933, 1033
BmsI	GCATC	4 cut(s)	145, 824, 865, 903
BplI	GAGNNNNNCTC	2 cut(s)	582, 614
BpmI	CTGGAG	1 cut(s)	891
Bpu10I	CCTNAGC	1 cut(s)	966
Bpu14I	TTCGAA	1 cut(s)	1064
BpuEI	CTTGAG	2 cut(s)	417, 634
BpuMI	CCSGG	1 cut(s)	1033
BsaBI	GATNNNNATC	1 cut(s)	402
BsaJI	CCNNGG	2 cut(s)	955, 1032
BsaWI	WCCGGW	2 cut(s)	197, 227
BsaXI	ACNNNNNCTCC	4 cut(s)	47, 77, 239, 269
Bsc4I	CCNNNNNNNGG	3 cut(s)	267, 531, 961
Bse118I	RCCGGY	1 cut(s)	886
Bse1I	ACTGG	1 cut(s)	129
Bse3DI	GCAATG	1 cut(s)	564
Bse8I	GATNNNNATC	1 cut(s)	402
BseBI	CCWGG	2 cut(s)	70, 933
BseDI	CCNNGG	2 cut(s)	955, 1032
BseGI	GGATG	5 cut(s)	35, 74, 521, 839, 1077
BseJI	GATNNNNATC	1 cut(s)	402
BseLI	CCNNNNNNNGG	3 cut(s)	267, 531, 961
BseMI	GCAATG	1 cut(s)	564
BseMII	CTCAG	1 cut(s)	957
BseNI	ACTGG	1 cut(s)	129
BseRI	GAGGAG	1 cut(s)	55
BseXI	GCAGC	5 cut(s)	224, 586, 654, 657, 848
BsgI	GTGCAG	1 cut(s)	997
BshFI	GGCC	3 cut(s)	73, 138, 507
BsiHKAI	GWGCWC	2 cut(s)	126, 150
BsiSI	CCGG	4 cut(s)	198, 228, 887, 1032
BslFI	GGGAC	5 cut(s)	104, 547, 1049, 1065, 1108
BslI	CCNNNNNNNGG	3 cut(s)	267, 531, 961
BsmFI	GGGAC	5 cut(s)	104, 547, 1049, 1065, 1108
BsnI	GGCC	3 cut(s)	73, 138, 507
Bsp119I	TTCGAA	1 cut(s)	1064
Bsp1286I	GDGCHC	2 cut(s)	126, 150
Bsp143I	GATC	5 cut(s)	110, 280, 763, 811, 1078
BspACI	CCGC	3 cut(s)	686, 711, 726
BspANI	GGCC	3 cut(s)	73, 138, 507
BspCNI	CTCAG	1 cut(s)	958
BspLI	GGNNCC	1 cut(s)	535
BspMAI	CTGCAG	1 cut(s)	701
BspMI	ACCTGC	1 cut(s)	690
BspPI	GGATC	3 cut(s)	118, 806, 1073
BspQI	GCTCTTC	1 cut(s)	1110
BspT104I	TTCGAA	1 cut(s)	1064
BsrDI	GCAATG	1 cut(s)	564
BsrFI	RCCGGY	1 cut(s)	886
BsrI	ACTGG	1 cut(s)	129
BssAI	RCCGGY	1 cut(s)	886
BssECI	CCNNGG	2 cut(s)	955, 1032
BssMI	GATC	5 cut(s)	110, 280, 763, 811, 1078
BssSI	CACGAG	1 cut(s)	407
BssT1I	CCWWGG	1 cut(s)	955
Bst2BI	CACGAG	1 cut(s)	407
Bst2UI	CCWGG	2 cut(s)	70, 933
Bst4CI	ACNGT	3 cut(s)	352, 803, 1040
Bst6I	CTCTTC	2 cut(s)	903, 1110
BstBI	TTCGAA	1 cut(s)	1064
BstC8I	GCNNGC	3 cut(s)	243, 343, 591
BstDEI	CTNAG	1 cut(s)	966
BstF5I	GGATG	5 cut(s)	35, 74, 521, 839, 1077
BstKTI	GATC	5 cut(s)	113, 283, 766, 814, 1081
BstMBI	GATC	5 cut(s)	110, 280, 763, 811, 1078
BstMWI	GCNNNNNNNGC	2 cut(s)	651, 875
BstNI	CCWGG	2 cut(s)	70, 933
BstSCI	CCNGG	3 cut(s)	68, 931, 1031
BstSFI	CTRYAG	1 cut(s)	697
BstV1I	GCAGC	5 cut(s)	224, 586, 654, 657, 848
BstXI	CCANNNNNNTGG	1 cut(s)	87
BsuRI	GGCC	3 cut(s)	73, 138, 507
BtsCI	GGATG	5 cut(s)	35, 74, 521, 839, 1077
BtsIMutI	CAGTG	1 cut(s)	136
BveI	ACCTGC	1 cut(s)	690
Cac8I	GCNNGC	3 cut(s)	243, 343, 591
Cfr10I	RCCGGY	1 cut(s)	886
Cfr13I	GGNCC	2 cut(s)	459, 534
Csp6I	GTAC	1 cut(s)	195
CviAII	CATG	1 cut(s)	379
CviQI	GTAC	1 cut(s)	195
DdeI	CTNAG	1 cut(s)	966
DpnI	GATC	5 cut(s)	112, 282, 765, 813, 1080
DpnII	GATC	5 cut(s)	110, 280, 763, 811, 1078
DrdI	GACNNNNNNGTC	1 cut(s)	780
DseDI	GACNNNNNNGTC	1 cut(s)	780
EaeI	YGGCCR	2 cut(s)	71, 136
Eam1104I	CTCTTC	2 cut(s)	903, 1110
EarI	CTCTTC	2 cut(s)	903, 1110
Ecl136II	GAGCTC	1 cut(s)	124
Eco130I	CCWWGG	1 cut(s)	955
Eco24I	GRGCYC	1 cut(s)	126
Eco47I	GGWCC	2 cut(s)	459, 534
Eco53kI	GAGCTC	1 cut(s)	124
EcoICRI	GAGCTC	1 cut(s)	124
EcoRII	CCWGG	2 cut(s)	68, 931
EcoT14I	CCWWGG	1 cut(s)	955
EcoT38I	GRGCYC	1 cut(s)	126
ErhI	CCWWGG	1 cut(s)	955
FaeI	CATG	1 cut(s)	382
FaqI	GGGAC	5 cut(s)	104, 547, 1049, 1065, 1108
FatI	CATG	1 cut(s)	378
FbaI	TGATCA	1 cut(s)	280
FblI	GTMKAC	2 cut(s)	316, 668
Fnu4HI	GCNGC	5 cut(s)	213, 575, 643, 646, 862
FokI	GGATG	5 cut(s)	22, 61, 508, 846, 1084
FriOI	GRGCYC	1 cut(s)	126
Fsp4HI	GCNGC	5 cut(s)	213, 575, 643, 646, 862
FspBI	CTAG	4 cut(s)	192, 767, 992, 1083
GluI	GCNGC	5 cut(s)	213, 575, 643, 646, 862
GsuI	CTGGAG	1 cut(s)	891
HaeIII	GGCC	3 cut(s)	73, 138, 507
HapII	CCGG	4 cut(s)	198, 228, 887, 1032
Hin1II	CATG	1 cut(s)	382
HincII	GTYRAC	1 cut(s)	669
HindII	GTYRAC	1 cut(s)	669
HinfI	GANTC	5 cut(s)	185, 313, 375, 437, 1053
HpaII	CCGG	4 cut(s)	198, 228, 887, 1032
HphI	GGTGA	4 cut(s)	118, 275, 876, 947
Hpy166II	GTNNAC	2 cut(s)	317, 669
Hpy188I	TCNGA	1 cut(s)	526
Hpy188III	TCNNGA	1 cut(s)	434
Hpy8I	GTNNAC	2 cut(s)	317, 669
Hpy99I	CGWCG	1 cut(s)	16
HpyAV	CCTTC	1 cut(s)	1042
HpyCH4III	ACNGT	3 cut(s)	352, 803, 1040
HpyCH4IV	ACGT	1 cut(s)	11
HpyCH4V	TGCA	9 cut(s)	158, 212, 544, 569, 699, 837, 864, 916, 978
HpyF10VI	GCNNNNNNNGC	2 cut(s)	651, 875
HpyF3I	CTNAG	1 cut(s)	966
HpySE526I	ACGT	1 cut(s)	11
Hsp92II	CATG	1 cut(s)	382
Ksp22I	TGATCA	1 cut(s)	280
Kzo9I	GATC	5 cut(s)	110, 280, 763, 811, 1078
LguI	GCTCTTC	1 cut(s)	1110
Lsp1109I	GCAGC	5 cut(s)	224, 586, 654, 657, 848
LweI	GCATC	4 cut(s)	145, 824, 865, 903
MaeI	CTAG	4 cut(s)	192, 767, 992, 1083
MaeII	ACGT	1 cut(s)	11
MaeIII	GTNAC	1 cut(s)	797
MalI	GATC	5 cut(s)	112, 282, 765, 813, 1080
MboI	GATC	5 cut(s)	110, 280, 763, 811, 1078
MboII	GAAGA	4 cut(s)	180, 484, 920, 1097
MhlI	GDGCHC	2 cut(s)	126, 150
MlsI	TGGCCA	1 cut(s)	73
MluCI	AATT	7 cut(s)	232, 358, 424, 445, 474, 705, 985
MluNI	TGGCCA	1 cut(s)	73
MlyI	GAGTC	2 cut(s)	322, 1047
Mox20I	TGGCCA	1 cut(s)	73
MscI	TGGCCA	1 cut(s)	73
MseI	TTAA	1 cut(s)	1044
MslI	CAYNNNNRTG	1 cut(s)	926
Msp20I	TGGCCA	1 cut(s)	73
MspI	CCGG	4 cut(s)	198, 228, 887, 1032
MspR9I	CCNGG	3 cut(s)	70, 933, 1033
MvaI	CCWGG	2 cut(s)	70, 933
MwoI	GCNNNNNNNGC	2 cut(s)	651, 875
NciI	CCSGG	1 cut(s)	1033
NdeII	GATC	5 cut(s)	110, 280, 763, 811, 1078
NlaIII	CATG	1 cut(s)	382
NlaIV	GGNNCC	1 cut(s)	535
NspV	TTCGAA	1 cut(s)	1064
PciSI	GCTCTTC	1 cut(s)	1110
PfeI	GAWTC	3 cut(s)	185, 375, 437
PflMI	CCANNNNNTGG	1 cut(s)	961
PkrI	GCNGC	5 cut(s)	214, 576, 644, 647, 863
PleI	GAGTC	2 cut(s)	321, 1047
PpsI	GAGTC	2 cut(s)	321, 1047
Psp124BI	GAGCTC	1 cut(s)	126
Psp6I	CCWGG	2 cut(s)	68, 931
PspGI	CCWGG	2 cut(s)	68, 931
PspN4I	GGNNCC	1 cut(s)	535
PspPI	GGNCC	2 cut(s)	459, 534
PstI	CTGCAG	1 cut(s)	701
RsaI	GTAC	1 cut(s)	196
RsaNI	GTAC	1 cut(s)	195
RseI	CAYNNNNRTG	1 cut(s)	926
SacI	GAGCTC	1 cut(s)	126
SalI	GTCGAC	1 cut(s)	667
SapI	GCTCTTC	1 cut(s)	1110
SaqAI	TTAA	1 cut(s)	1044
SatI	GCNGC	5 cut(s)	213, 575, 643, 646, 862
Sau3AI	GATC	5 cut(s)	110, 280, 763, 811, 1078
Sau96I	GGNCC	2 cut(s)	459, 534
SchI	GAGTC	2 cut(s)	322, 1047
ScrFI	CCNGG	3 cut(s)	70, 933, 1033
SduI	GDGCHC	2 cut(s)	126, 150
SfaNI	GCATC	4 cut(s)	145, 824, 865, 903
SfcI	CTRYAG	1 cut(s)	697
SfuI	TTCGAA	1 cut(s)	1064
SinI	GGWCC	2 cut(s)	459, 534
SmiMI	CAYNNNNRTG	1 cut(s)	926
SmlI	CTYRAG	2 cut(s)	432, 649
SmoI	CTYRAG	2 cut(s)	432, 649
Sse9I	AATT	7 cut(s)	232, 358, 424, 445, 474, 705, 985
SsiI	CCGC	3 cut(s)	686, 711, 726
SspMI	CTAG	4 cut(s)	192, 767, 992, 1083
SstI	GAGCTC	1 cut(s)	126
StyD4I	CCNGG	3 cut(s)	68, 931, 1031
StyI	CCWWGG	1 cut(s)	955
TaaI	ACNGT	3 cut(s)	352, 803, 1040
TaiI	ACGT	1 cut(s)	14
TaqI	TCGA	6 cut(s)	14, 222, 365, 600, 668, 1064
TasI	AATT	7 cut(s)	232, 358, 424, 445, 474, 705, 985
TfiI	GAWTC	3 cut(s)	185, 375, 437
Tru1I	TTAA	1 cut(s)	1044
Tru9I	TTAA	1 cut(s)	1044
TscAI	CASTG	1 cut(s)	136
TseI	GCWGC	5 cut(s)	212, 574, 642, 645, 861
TspDTI	ATGAA	2 cut(s)	367, 670
TspGWI	ACGGA	1 cut(s)	451
TspRI	CASTG	1 cut(s)	136
Van91I	CCANNNNNTGG	1 cut(s)	961
VpaK11BI	GGWCC	2 cut(s)	459, 534
XapI	RAATTY	2 cut(s)	232, 424
XmiI	GTMKAC	2 cut(s)	316, 668
XspI	CTAG	4 cut(s)	192, 767, 992, 1083

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.