MD15G1265300.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Reverse (-)
22752408 .. 22753241
834 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1265300.v1.1.491

Sequence Viewer

Length: 291 bp
ATGGAGGCTGCACCAATTCGGATTGATAGGAAACCATCCATAGAAACCGAGCCAAGAACGTTGGGAATGGAACAAATTGAATTTGCAAGGGAGGCAGCCAAGTATGTGGTGAATACAAAGAATATGGAAGAAGCAATGCGCATTTTCACAGAGGGTTTGGAGCCAGTGGTAAGTTCGATCCAGCAAAGTGGTGATGAAGTGATGATGGCTTCAGTTGAGGAGCCTGAGTACTCGGAACCTTATTACAGAAGACCACGAGGACCCAGGGAGATTGTCTCAGCACCTTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

11.0

Weight (kDa)

4.72

Isoelectric Point (pI)

65.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 140
AclI AACGTT 1 cut(s) 59
AclWI GGATC 1 cut(s) 172
AcsI RAATTY 1 cut(s) 80
AcuI CTGAAG 1 cut(s) 195
AfaI GTAC 1 cut(s) 230
AgsI TTSAA 1 cut(s) 80
AjnI CCWGG 1 cut(s) 263
Alw26I GTCTC 1 cut(s) 280
AlwI GGATC 1 cut(s) 172
ApeKI GCWGC 2 cut(s) 8, 95
ApoI RAATTY 1 cut(s) 80
AspLEI GCGC 1 cut(s) 141
AspS9I GGNCC 1 cut(s) 260
AsuHPI GGTGA 2 cut(s) 121, 203
AvaII GGWCC 1 cut(s) 260
BauI CACGAG 1 cut(s) 255
BbsI GAAGAC 1 cut(s) 256
BbvI GCAGC 1 cut(s) 107
BccI CCATC 2 cut(s) 43, 199
BciT130I CCWGG 1 cut(s) 265
BcoDI GTCTC 1 cut(s) 280
BisI GCNGC 2 cut(s) 9, 96
BlsI GCNGC 2 cut(s) 10, 97
BmcAI AGTACT 1 cut(s) 230
Bme1390I CCNGG 1 cut(s) 265
Bme18I GGWCC 1 cut(s) 260
BmgT120I GGNCC 1 cut(s) 260
BmiI GGNNCC 4 cut(s) 162, 222, 237, 262
BmrFI CCNGG 1 cut(s) 265
BpiI GAAGAC 1 cut(s) 256
BplI GAGNNNNNCTC 1 cut(s) 260
BsaJI CCNNGG 2 cut(s) 263, 264
BsaXI ACNNNNNCTCC 2 cut(s) 212, 242
Bse1I ACTGG 1 cut(s) 164
Bse3DI GCAATG 1 cut(s) 141
BseBI CCWGG 1 cut(s) 265
BseDI CCNNGG 2 cut(s) 263, 264
BseGI GGATG 1 cut(s) 35
BseMI GCAATG 1 cut(s) 141
BseMII CTCAG 2 cut(s) 216, 291
BseNI ACTGG 1 cut(s) 164
BseRI GAGGAG 1 cut(s) 233
BseXI GCAGC 1 cut(s) 107
BsmAI GTCTC 1 cut(s) 280
Bsp143I GATC 1 cut(s) 177
BspCNI CTCAG 2 cut(s) 217, 290
BspLI GGNNCC 4 cut(s) 162, 222, 237, 262
BspPI GGATC 1 cut(s) 172
BsrDI GCAATG 1 cut(s) 141
BsrI ACTGG 1 cut(s) 164
BssECI CCNNGG 2 cut(s) 263, 264
BssMI GATC 1 cut(s) 177
BssSI CACGAG 1 cut(s) 255
Bst2BI CACGAG 1 cut(s) 255
Bst2UI CCWGG 1 cut(s) 265
BstDEI CTNAG 2 cut(s) 225, 277
BstF5I GGATG 1 cut(s) 35
BstHHI GCGC 1 cut(s) 141
BstKTI GATC 1 cut(s) 180
BstMAI GTCTC 1 cut(s) 280
BstMBI GATC 1 cut(s) 177
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstNI CCWGG 1 cut(s) 265
BstSCI CCNGG 1 cut(s) 263
BstV1I GCAGC 1 cut(s) 107
BstV2I GAAGAC 1 cut(s) 256
BstXI CCANNNNNNTGG 2 cut(s) 106, 188
BtsCI GGATG 1 cut(s) 35
BtsIMutI CAGTG 1 cut(s) 171
CfoI GCGC 1 cut(s) 141
Cfr13I GGNCC 1 cut(s) 260
Csp6I GTAC 1 cut(s) 229
CviJI RGCY 6 cut(s) 8, 52, 98, 163, 209, 223
CviKI_1 RGCY 6 cut(s) 8, 52, 98, 163, 209, 223
CviQI GTAC 1 cut(s) 229
DdeI CTNAG 2 cut(s) 225, 277
DpnI GATC 1 cut(s) 179
DpnII GATC 1 cut(s) 177
Eco47I GGWCC 1 cut(s) 260
Eco57I CTGAAG 1 cut(s) 195
EcoO109I RGGNCCY 1 cut(s) 260
EcoRII CCWGG 1 cut(s) 263
FaiI YATR 3 cut(s) 41, 105, 125
Fnu4HI GCNGC 2 cut(s) 9, 96
FokI GGATG 1 cut(s) 22
Fsp4HI GCNGC 2 cut(s) 9, 96
FspAI RTGCGCAY 1 cut(s) 140
FspI TGCGCA 1 cut(s) 140
GlaI GCGC 1 cut(s) 140
GluI GCNGC 2 cut(s) 9, 96
HhaI GCGC 1 cut(s) 141
Hin6I GCGC 1 cut(s) 139
HinP1I GCGC 1 cut(s) 139
HphI GGTGA 2 cut(s) 121, 203
Hpy188I TCNGA 2 cut(s) 21, 235
HpyCH4IV ACGT 1 cut(s) 59
HpyCH4V TGCA 2 cut(s) 11, 86
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
HpyF3I CTNAG 2 cut(s) 225, 277
HpySE526I ACGT 1 cut(s) 59
HspAI GCGC 1 cut(s) 139
Kzo9I GATC 1 cut(s) 177
LmnI GCTCC 2 cut(s) 160, 220
LpnPI CCDG 5 cut(s) 177, 194, 237, 250, 277
Lsp1109I GCAGC 1 cut(s) 107
MaeII ACGT 1 cut(s) 59
MalI GATC 1 cut(s) 179
MboI GATC 1 cut(s) 177
MboII GAAGA 2 cut(s) 140, 261
MluCI AATT 3 cut(s) 15, 75, 80
MnlI CCTC 4 cut(s) 85, 145, 211, 251
MspR9I CCNGG 1 cut(s) 265
MvaI CCWGG 1 cut(s) 265
MwoI GCNNNNNNNGC 1 cut(s) 92
NdeII GATC 1 cut(s) 177
NlaIV GGNNCC 4 cut(s) 162, 222, 237, 262
NsbI TGCGCA 1 cut(s) 140
PasI CCCWGGG 1 cut(s) 264
PkrI GCNGC 2 cut(s) 10, 97
PpuMI RGGWCCY 1 cut(s) 260
Psp1406I AACGTT 1 cut(s) 59
Psp5II RGGWCCY 1 cut(s) 260
Psp6I CCWGG 1 cut(s) 263
PspGI CCWGG 1 cut(s) 263
PspN4I GGNNCC 4 cut(s) 162, 222, 237, 262
PspPI GGNCC 1 cut(s) 260
PspPPI RGGWCCY 1 cut(s) 260
RsaI GTAC 1 cut(s) 230
RsaNI GTAC 1 cut(s) 229
SatI GCNGC 2 cut(s) 9, 96
Sau3AI GATC 1 cut(s) 177
Sau96I GGNCC 1 cut(s) 260
ScaI AGTACT 1 cut(s) 230
ScrFI CCNGG 1 cut(s) 265
SetI ASST 3 cut(s) 62, 241, 286
SinI GGWCC 1 cut(s) 260
Sse9I AATT 3 cut(s) 15, 75, 80
StyD4I CCNGG 1 cut(s) 263
TaiI ACGT 1 cut(s) 62
TaqI TCGA 1 cut(s) 176
TasI AATT 3 cut(s) 15, 75, 80
TatI WGTACW 1 cut(s) 228
TscAI CASTG 1 cut(s) 171
TseI GCWGC 2 cut(s) 8, 95
TspDTI ATGAA 1 cut(s) 210
TspRI CASTG 1 cut(s) 171
VpaK11BI GGWCC 1 cut(s) 260
XapI RAATTY 1 cut(s) 80
ZrmI AGTACT 1 cut(s) 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.