Rh2DG156900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
13113476 .. 13115487
2012 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG156900.1

Sequence Viewer

Length: 291 bp
ATGGAAGGCGCGTCGCAGCTGGTACGGACTGGAAGGAAGTCATCTATAGAAAGTGAGCCGAGAACGCTGGGGTTTCATCAGATCCAATATGCAAGGGAGGCAGCTGAGTACGTGATGAATACAAAGGATTTAGAAGAAGCAAAGCGCATTTTCACTCAGGGATTACAGCCAGTAGTGAGCGTGATGAAACCAACTGGAGAGGAGATGACGGATTCGGTTGACGAATTTGAGTATTCAGAAGATCGATACCGATTATCTGAACTAAGGGATGTAGTCACAGCGCCATTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

11.01

Weight (kDa)

4.77

Isoelectric Point (pI)

45.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 11
AclWI GGATC 1 cut(s) 76
AcsI RAATTY 1 cut(s) 224
AfaI GTAC 2 cut(s) 24, 110
AluBI AGCT 2 cut(s) 19, 104
AluI AGCT 2 cut(s) 19, 104
AlwI GGATC 1 cut(s) 76
ApeKI GCWGC 2 cut(s) 16, 101
ApoI RAATTY 1 cut(s) 224
AspLEI GCGC 3 cut(s) 11, 147, 283
BbvI GCAGC 2 cut(s) 28, 113
BfmI CTRYAG 1 cut(s) 45
BfoI RGCGCY 1 cut(s) 284
BisI GCNGC 2 cut(s) 17, 102
BlsI GCNGC 2 cut(s) 18, 103
BpmI CTGGAG 1 cut(s) 216
Bsa29I ATCGAT 1 cut(s) 244
BsaAI YACGTR 1 cut(s) 112
Bse1I ACTGG 3 cut(s) 34, 170, 199
BseCI ATCGAT 1 cut(s) 244
BseGI GGATG 1 cut(s) 274
BseMII CTCAG 2 cut(s) 96, 170
BseNI ACTGG 3 cut(s) 34, 170, 199
BseRI GAGGAG 1 cut(s) 215
BseXI GCAGC 2 cut(s) 28, 113
BseYI CCCAGC 1 cut(s) 67
Bsh1236I CGCG 1 cut(s) 11
BshVI ATCGAT 1 cut(s) 244
Bsp143I GATC 2 cut(s) 81, 241
BspCNI CTCAG 2 cut(s) 97, 169
BspDI ATCGAT 1 cut(s) 244
BspFNI CGCG 1 cut(s) 11
BspPI GGATC 1 cut(s) 76
BsrI ACTGG 3 cut(s) 34, 170, 199
BssMI GATC 2 cut(s) 81, 241
BstBAI YACGTR 1 cut(s) 112
BstDEI CTNAG 3 cut(s) 105, 156, 263
BstF5I GGATG 1 cut(s) 274
BstFNI CGCG 1 cut(s) 11
BstH2I RGCGCY 1 cut(s) 284
BstHHI GCGC 3 cut(s) 11, 147, 283
BstKTI GATC 2 cut(s) 84, 244
BstMBI GATC 2 cut(s) 81, 241
BstMWI GCNNNNNNNGC 2 cut(s) 64, 98
BstSFI CTRYAG 1 cut(s) 45
BstUI CGCG 1 cut(s) 11
BstV1I GCAGC 2 cut(s) 28, 113
BstX2I RGATCY 1 cut(s) 81
BstYI RGATCY 1 cut(s) 81
Bsu15I ATCGAT 1 cut(s) 244
BsuTUI ATCGAT 1 cut(s) 244
BtsCI GGATG 1 cut(s) 274
CfoI GCGC 3 cut(s) 11, 147, 283
ClaI ATCGAT 1 cut(s) 244
Csp6I GTAC 2 cut(s) 23, 109
CviJI RGCY 4 cut(s) 19, 58, 104, 169
CviKI_1 RGCY 4 cut(s) 19, 58, 104, 169
CviQI GTAC 2 cut(s) 23, 109
DdeI CTNAG 3 cut(s) 105, 156, 263
DpnI GATC 2 cut(s) 83, 243
DpnII GATC 2 cut(s) 81, 241
FaiI YATR 2 cut(s) 47, 90
Fnu4HI GCNGC 2 cut(s) 17, 102
FokI GGATG 1 cut(s) 281
Fsp4HI GCNGC 2 cut(s) 17, 102
GlaI GCGC 3 cut(s) 10, 146, 282
GluI GCNGC 2 cut(s) 17, 102
GsaI CCCAGC 1 cut(s) 71
GsuI CTGGAG 1 cut(s) 216
HaeII RGCGCY 1 cut(s) 284
HhaI GCGC 3 cut(s) 11, 147, 283
Hin6I GCGC 3 cut(s) 9, 145, 281
HinP1I GCGC 3 cut(s) 9, 145, 281
HincII GTYRAC 1 cut(s) 220
HindII GTYRAC 1 cut(s) 220
HinfI GANTC 1 cut(s) 212
Hpy166II GTNNAC 1 cut(s) 220
Hpy188I TCNGA 3 cut(s) 81, 238, 259
Hpy8I GTNNAC 1 cut(s) 220
Hpy99I CGWCG 1 cut(s) 16
HpyAV CCTTC 1 cut(s) 27
HpyCH4IV ACGT 1 cut(s) 111
HpyCH4V TGCA 1 cut(s) 92
HpyF10VI GCNNNNNNNGC 2 cut(s) 64, 98
HpyF3I CTNAG 3 cut(s) 105, 156, 263
HpySE526I ACGT 1 cut(s) 111
HspAI GCGC 3 cut(s) 9, 145, 281
Kzo9I GATC 2 cut(s) 81, 241
LpnPI CCDG 6 cut(s) 5, 15, 53, 143, 180, 183
Lsp1109I GCAGC 2 cut(s) 28, 113
MaeII ACGT 1 cut(s) 111
MaeIII GTNAC 1 cut(s) 274
MalI GATC 2 cut(s) 83, 243
MboI GATC 2 cut(s) 81, 241
MboII GAAGA 2 cut(s) 146, 251
MflI RGATCY 1 cut(s) 81
MluCI AATT 1 cut(s) 224
MnlI CCTC 2 cut(s) 91, 193
MspA1I CMGCKG 2 cut(s) 19, 104
MvnI CGCG 1 cut(s) 11
MwoI GCNNNNNNNGC 2 cut(s) 64, 98
NdeII GATC 2 cut(s) 81, 241
NmeAIII GCCGAG 1 cut(s) 84
NmuCI GTSAC 1 cut(s) 274
PfeI GAWTC 1 cut(s) 212
PkrI GCNGC 2 cut(s) 18, 103
Ppu21I YACGTR 1 cut(s) 112
PspFI CCCAGC 1 cut(s) 67
PsuI RGATCY 1 cut(s) 81
PvuII CAGCTG 2 cut(s) 19, 104
RsaI GTAC 2 cut(s) 24, 110
RsaNI GTAC 2 cut(s) 23, 109
SatI GCNGC 2 cut(s) 17, 102
Sau3AI GATC 2 cut(s) 81, 241
SetI ASST 3 cut(s) 21, 106, 114
SfcI CTRYAG 1 cut(s) 45
Sse9I AATT 1 cut(s) 224
TaiI ACGT 1 cut(s) 114
TaqI TCGA 1 cut(s) 244
TasI AATT 1 cut(s) 224
TfiI GAWTC 1 cut(s) 212
TseFI GTSAC 1 cut(s) 274
TseI GCWGC 2 cut(s) 16, 101
Tsp45I GTSAC 1 cut(s) 274
TspDTI ATGAA 3 cut(s) 65, 131, 200
TspGWI ACGGA 2 cut(s) 40, 224
XapI RAATTY 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.