Prupe.1G032700_v2.0.a1

Potato inhibitor I family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0000470
Physical Location & Seq
Forward (+)
2278899 .. 2279637
739 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G032700.1

Sequence Viewer

Length: 219 bp
ATGGGTTCAGAATGTGAAGGCAAGGGTTCGTGGCCAGAGCTTGTTGGAGTGGAGGGGGAGGTTGCCAAAGCAACAATTGAGAGAGAGAACCCTATTGTGACTGCTAAGATTGTGGTTGAAGGAGAAACATATGTCATCACCAACTACGATTGCTATCGGGTTTGGGTATGGGTTGATAAAGATGATCGGCTTGTCACAAGGCCTCCCATAATTGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
potato_inhibit

Protein Analysis

73

Amino Acids

8.07

Weight (kDa)

4.55

Isoelectric Point (pI)

12.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000470)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G43570 AT5G43570 AT5G43580
fragaria_vesca FvH4_4g02840 FvH4_4g02850 FvH4_4g02860 FvH4_4g02870 FvH4_4g02880 FvH4_4g02930
malus_domestica MD13G1208300.v1.1 MD13G1208400.v1.1 MD13G1208500.v1.1 MD13G1208700.v1.1 MD16G1210300.v1.1 MD16G1210400.v1.1
prunus_persica Prupe.1G032000_v2.0.a1 Prupe.1G032100_v2.0.a1 Prupe.1G032400_v2.0.a1 Prupe.1G032500_v2.0.a1 Prupe.1G032700_v2.0.a1 Prupe.I000200_v2.0.a1 Prupe.I000300_v2.0.a1
pyrus_communis pycom13g18030 pycom13g18040 pycom13g18050 pycom13g18060 pycom13g18080
rosa_chinensis RchiOBHm_Chr4g0390821 RchiOBHm_Chr4g0390831 RchiOBHm_Chr4g0390841 RchiOBHm_Chr4g0390891 RchiOBHm_Chr4g0390911 RchiOBHm_Chr4g0390921 RchiOBHm_Chr4g0390951 RchiOBHm_Chr4g0390971
rosa_laevigata RLG00000009909
rosa_multiflora Rmu_co8497379.1_g000001 Rmu_sc0000171.1_g000002 Rmu_sc0000171.1_g000003 Rmu_sc0000171.1_g000004 Rmu_sc0000171.1_g000009 Rmu_sc0000171.1_g000010 Rmu_sc0000171.1_g000014 Rmu_sc0000171.1_g000018 Rmu_sc0000171.1_g000019 Rmu_sc0001824.1_g000004 Rmu_sc0016732.1_g000001
rosa_roxburghii Rroxscaffold_5G00336740 Rroxscaffold_5G00336750 Rroxscaffold_5G00336760 Rroxscaffold_5G00336770 Rroxscaffold_5G00336790 Rroxscaffold_5G00336830
rosa_rugosa Rorug03G0331900 Rorug03G0331900 Rorug03G0331900 Rorug03G0332000 Rorug03G0332300 Rorug03G0332500
rosa_samantha Rh4AG033300 Rh4AG033400 Rh4AG033500 Rh4AG033600 Rh4AG033800 Rh4AG034000 Rh4BG027200 Rh4BG027300 Rh4BG027500 Rh4BG027700 Rh4BG027800 Rh4BG028100 Rh4BG028200 Rh4BG028400 Rh4CG036900 Rh4CG037000 Rh4CG037200 Rh4CG037400 Rh4DG030300 Rh4DG030400 Rh4DG030500 Rh4DG030600 Rh4DG030800 Rh4DG031100 Rh4DG031300
rosa_wichuraiana Rw4G002560 Rw4G002580 Rw4G002600 Rw4G002610 Rw4G002620 Rw4G002640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 32
AfiI CCNNNNNNNGG 1 cut(s) 212
AgsI TTSAA 1 cut(s) 119
AluBI AGCT 1 cut(s) 40
AluI AGCT 1 cut(s) 40
AoxI GGCC 2 cut(s) 32, 200
AsuHPI GGTGA 1 cut(s) 130
BalI TGGCCA 1 cut(s) 34
BsaBI GATNNNNATC 1 cut(s) 153
BsaXI ACNNNNNCTCC 2 cut(s) 187, 217
Bsc4I CCNNNNNNNGG 1 cut(s) 212
Bse8I GATNNNNATC 1 cut(s) 153
BseJI GATNNNNATC 1 cut(s) 153
BseLI CCNNNNNNNGG 1 cut(s) 212
BshFI GGCC 2 cut(s) 34, 202
BslI CCNNNNNNNGG 1 cut(s) 212
BsnI GGCC 2 cut(s) 34, 202
Bsp143I GATC 1 cut(s) 184
BspANI GGCC 2 cut(s) 34, 202
BssMI GATC 1 cut(s) 184
BstDEI CTNAG 1 cut(s) 105
BstKTI GATC 1 cut(s) 187
BstMBI GATC 1 cut(s) 184
BsuRI GGCC 2 cut(s) 34, 202
CviJI RGCY 4 cut(s) 34, 40, 190, 202
CviKI_1 RGCY 4 cut(s) 34, 40, 190, 202
DdeI CTNAG 1 cut(s) 105
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
EaeI YGGCCR 1 cut(s) 32
Eco147I AGGCCT 1 cut(s) 202
FaiI YATR 4 cut(s) 130, 132, 169, 209
FauNDI CATATG 1 cut(s) 130
HaeIII GGCC 2 cut(s) 34, 202
HphI GGTGA 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 10
HpyAV CCTTC 2 cut(s) 11, 113
HpyF3I CTNAG 1 cut(s) 105
Kzo9I GATC 1 cut(s) 184
LpnPI CCDG 1 cut(s) 48
MaeIII GTNAC 2 cut(s) 97, 193
MalI GATC 1 cut(s) 186
MboI GATC 1 cut(s) 184
MfeI CAATTG 1 cut(s) 75
MlsI TGGCCA 1 cut(s) 34
MluCI AATT 2 cut(s) 75, 210
MluNI TGGCCA 1 cut(s) 34
MmeI TCCRAC 1 cut(s) 25
MnlI CCTC 3 cut(s) 46, 52, 213
Mox20I TGGCCA 1 cut(s) 34
MscI TGGCCA 1 cut(s) 34
MseI TTAA 1 cut(s) 217
Msp20I TGGCCA 1 cut(s) 34
MunI CAATTG 1 cut(s) 75
NdeI CATATG 1 cut(s) 130
NdeII GATC 1 cut(s) 184
NmuCI GTSAC 2 cut(s) 97, 193
PceI AGGCCT 1 cut(s) 202
SaqAI TTAA 1 cut(s) 217
Sau3AI GATC 1 cut(s) 184
SetI ASST 2 cut(s) 42, 63
SgeI CNNG 7 cut(s) 34, 42, 47, 53, 170, 203, 210
Sse9I AATT 2 cut(s) 75, 210
SseBI AGGCCT 1 cut(s) 202
StuI AGGCCT 1 cut(s) 202
TasI AATT 2 cut(s) 75, 210
Tru1I TTAA 1 cut(s) 217
Tru9I TTAA 1 cut(s) 217
TseFI GTSAC 2 cut(s) 97, 193
Tsp45I GTSAC 2 cut(s) 97, 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.