Rh4DG030300

Potato inhibitor I family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0000470
Physical Location & Seq
Forward (+)
5215769 .. 5217768
2000 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG030300.1

Sequence Viewer

Length: 354 bp
ATGCCGTGTGCAGGTAAGAATTTGTGGCCTGAGCTCGTCGGAGCCAAGGGAAGGGAGGCGGAGAGAAAAGTTGAAAGCGAGAATGATTTAGTCGAGGCTGTCATTGTGAAAGAAGGATCATTTGTCATTGGGGCTCATGAGGTAATGAGATCTAGGCCAGGTAAGGATTCGTGGCCTGAGCTCGTCGGAGCCAAGGTGACAGAGGCGGAGGCAAAAATTGAGAGTGAGAATGATTTAGTCAAGGTTGTCATCGTGAAAGAAGGATCATATGTCACTCATGATTTTCGGTGTAATAGGGTTCGAGTTTGGGTCGATAAACATGGCACCGTCACCAGGGTCCCCACAAGTGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
potato_inhibit

Protein Analysis

117

Amino Acids

12.93

Weight (kDa)

6.31

Isoelectric Point (pI)

20.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
potato_inhibit PF00280 6 - 47 1e-08 Potato inhibitor I family
potato_inhibit PF00280 55 - 117 8.7e-26 Potato inhibitor I family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000470)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G43570 AT5G43570 AT5G43580
fragaria_vesca FvH4_4g02840 FvH4_4g02850 FvH4_4g02860 FvH4_4g02870 FvH4_4g02880 FvH4_4g02930
malus_domestica MD13G1208300.v1.1 MD13G1208400.v1.1 MD13G1208500.v1.1 MD13G1208700.v1.1 MD16G1210300.v1.1 MD16G1210400.v1.1
prunus_persica Prupe.1G032000_v2.0.a1 Prupe.1G032100_v2.0.a1 Prupe.1G032400_v2.0.a1 Prupe.1G032500_v2.0.a1 Prupe.1G032700_v2.0.a1 Prupe.I000200_v2.0.a1 Prupe.I000300_v2.0.a1
pyrus_communis pycom13g18030 pycom13g18040 pycom13g18050 pycom13g18060 pycom13g18080
rosa_chinensis RchiOBHm_Chr4g0390821 RchiOBHm_Chr4g0390831 RchiOBHm_Chr4g0390841 RchiOBHm_Chr4g0390891 RchiOBHm_Chr4g0390911 RchiOBHm_Chr4g0390921 RchiOBHm_Chr4g0390951 RchiOBHm_Chr4g0390971
rosa_laevigata RLG00000009909
rosa_multiflora Rmu_co8497379.1_g000001 Rmu_sc0000171.1_g000002 Rmu_sc0000171.1_g000003 Rmu_sc0000171.1_g000004 Rmu_sc0000171.1_g000009 Rmu_sc0000171.1_g000010 Rmu_sc0000171.1_g000014 Rmu_sc0000171.1_g000018 Rmu_sc0000171.1_g000019 Rmu_sc0001824.1_g000004 Rmu_sc0016732.1_g000001
rosa_roxburghii Rroxscaffold_5G00336740 Rroxscaffold_5G00336750 Rroxscaffold_5G00336760 Rroxscaffold_5G00336770 Rroxscaffold_5G00336790 Rroxscaffold_5G00336830
rosa_rugosa Rorug03G0331900 Rorug03G0331900 Rorug03G0331900 Rorug03G0332000 Rorug03G0332300 Rorug03G0332500
rosa_samantha Rh4AG033300 Rh4AG033400 Rh4AG033500 Rh4AG033600 Rh4AG033800 Rh4AG034000 Rh4BG027200 Rh4BG027300 Rh4BG027500 Rh4BG027700 Rh4BG027800 Rh4BG028100 Rh4BG028200 Rh4BG028400 Rh4CG036900 Rh4CG037000 Rh4CG037200 Rh4CG037400 Rh4DG030300 Rh4DG030400 Rh4DG030500 Rh4DG030600 Rh4DG030800 Rh4DG031100 Rh4DG031300
rosa_wichuraiana Rw4G002560 Rw4G002580 Rw4G002600 Rw4G002610 Rw4G002620 Rw4G002640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 2
AccB1I GGYRCC 1 cut(s) 323
AciI CCGC 2 cut(s) 59, 206
AclWI GGATC 2 cut(s) 124, 271
AcsI RAATTY 1 cut(s) 19
AfiI CCNNNNNNNGG 4 cut(s) 11, 51, 333, 347
AgsI TTSAA 1 cut(s) 74
AjnI CCWGG 2 cut(s) 157, 332
AluBI AGCT 2 cut(s) 34, 181
AluI AGCT 2 cut(s) 34, 181
Alw21I GWGCWC 2 cut(s) 36, 183
AlwI GGATC 2 cut(s) 124, 271
AoxI GGCC 3 cut(s) 26, 155, 173
ApoI RAATTY 1 cut(s) 19
AspS9I GGNCC 1 cut(s) 337
AsuHPI GGTGA 2 cut(s) 208, 322
AvaII GGWCC 1 cut(s) 337
BanI GGYRCC 1 cut(s) 323
BanII GRGCYC 3 cut(s) 36, 136, 183
Bbv12I GWGCWC 2 cut(s) 36, 183
BciT130I CCWGG 2 cut(s) 159, 334
BfaI CTAG 1 cut(s) 153
BfuAI ACCTGC 1 cut(s) 2
BglII AGATCT 1 cut(s) 149
Bme1390I CCNGG 2 cut(s) 159, 334
Bme18I GGWCC 1 cut(s) 337
BmgT120I GGNCC 1 cut(s) 337
BmiI GGNNCC 5 cut(s) 43, 190, 325, 338, 339
BmrFI CCNGG 2 cut(s) 159, 334
Bpu10I CCTNAGC 2 cut(s) 30, 177
BsaJI CCNNGG 3 cut(s) 45, 192, 333
BsaXI ACNNNNNCTCC 2 cut(s) 180, 210
Bsc4I CCNNNNNNNGG 4 cut(s) 11, 51, 333, 347
BseBI CCWGG 2 cut(s) 159, 334
BseDI CCNNGG 3 cut(s) 45, 192, 333
BseLI CCNNNNNNNGG 4 cut(s) 11, 51, 333, 347
BseMII CTCAG 2 cut(s) 21, 168
BsgI GTGCAG 1 cut(s) 30
BshFI GGCC 3 cut(s) 28, 157, 175
BshNI GGYRCC 1 cut(s) 323
BsiHKAI GWGCWC 2 cut(s) 36, 183
BslFI GGGAC 1 cut(s) 323
BslI CCNNNNNNNGG 4 cut(s) 11, 51, 333, 347
BsmFI GGGAC 1 cut(s) 323
BsnI GGCC 3 cut(s) 28, 157, 175
Bsp1286I GDGCHC 3 cut(s) 36, 136, 183
Bsp143I GATC 3 cut(s) 116, 149, 263
BspACI CCGC 2 cut(s) 59, 206
BspANI GGCC 3 cut(s) 28, 157, 175
BspCNI CTCAG 2 cut(s) 22, 169
BspHI TCATGA 2 cut(s) 136, 277
BspLI GGNNCC 5 cut(s) 43, 190, 325, 338, 339
BspMI ACCTGC 1 cut(s) 2
BspPI GGATC 2 cut(s) 124, 271
BspT107I GGYRCC 1 cut(s) 323
BssECI CCNNGG 3 cut(s) 45, 192, 333
BssMI GATC 3 cut(s) 116, 149, 263
BssT1I CCWWGG 2 cut(s) 45, 192
Bst2UI CCWGG 2 cut(s) 159, 334
Bst4CI ACNGT 1 cut(s) 328
BstDEI CTNAG 2 cut(s) 30, 177
BstKTI GATC 3 cut(s) 119, 152, 266
BstMBI GATC 3 cut(s) 116, 149, 263
BstNI CCWGG 2 cut(s) 159, 334
BstSCI CCNGG 2 cut(s) 157, 332
BstX2I RGATCY 1 cut(s) 149
BstYI RGATCY 1 cut(s) 149
BsuRI GGCC 3 cut(s) 28, 157, 175
BveI ACCTGC 1 cut(s) 2
CciI TCATGA 2 cut(s) 136, 277
Cfr13I GGNCC 1 cut(s) 337
CviAII CATG 3 cut(s) 137, 278, 320
CviJI RGCY 9 cut(s) 28, 34, 44, 98, 134, 157, 175, 181, 191
CviKI_1 RGCY 9 cut(s) 28, 34, 44, 98, 134, 157, 175, 181, 191
DdeI CTNAG 2 cut(s) 30, 177
DpnI GATC 3 cut(s) 118, 151, 265
DpnII GATC 3 cut(s) 116, 149, 263
EciI GGCGGA 2 cut(s) 74, 221
Ecl136II GAGCTC 2 cut(s) 34, 181
Eco130I CCWWGG 2 cut(s) 45, 192
Eco24I GRGCYC 3 cut(s) 36, 136, 183
Eco47I GGWCC 1 cut(s) 337
Eco53kI GAGCTC 2 cut(s) 34, 181
EcoICRI GAGCTC 2 cut(s) 34, 181
EcoO109I RGGNCCY 1 cut(s) 337
EcoRII CCWGG 2 cut(s) 157, 332
EcoT14I CCWWGG 2 cut(s) 45, 192
EcoT38I GRGCYC 3 cut(s) 36, 136, 183
ErhI CCWWGG 2 cut(s) 45, 192
FaeI CATG 3 cut(s) 140, 281, 323
FaiI YATR 5 cut(s) 138, 268, 270, 279, 321
FaqI GGGAC 1 cut(s) 323
FatI CATG 3 cut(s) 136, 277, 319
FauNDI CATATG 1 cut(s) 268
FriOI GRGCYC 3 cut(s) 36, 136, 183
FspBI CTAG 1 cut(s) 153
HaeIII GGCC 3 cut(s) 28, 157, 175
Hin1II CATG 3 cut(s) 140, 281, 323
HinfI GANTC 1 cut(s) 167
HphI GGTGA 2 cut(s) 208, 322
Hpy188I TCNGA 2 cut(s) 41, 188
Hpy188III TCNNGA 3 cut(s) 137, 253, 278
Hpy99I CGWCG 2 cut(s) 41, 188
HpyAV CCTTC 3 cut(s) 45, 107, 254
HpyCH4III ACNGT 1 cut(s) 328
HpyCH4V TGCA 1 cut(s) 11
HpyF3I CTNAG 2 cut(s) 30, 177
Hsp92II CATG 3 cut(s) 140, 281, 323
KflI GGGWCCC 1 cut(s) 337
Kzo9I GATC 3 cut(s) 116, 149, 263
LmnI GCTCC 2 cut(s) 41, 188
LpnPI CCDG 6 cut(s) 42, 144, 171, 189, 319, 346
MaeI CTAG 1 cut(s) 153
MaeIII GTNAC 3 cut(s) 196, 271, 328
MalI GATC 3 cut(s) 118, 151, 265
MboI GATC 3 cut(s) 116, 149, 263
MflI RGATCY 1 cut(s) 149
MhlI GDGCHC 3 cut(s) 36, 136, 183
MluCI AATT 2 cut(s) 19, 216
MmeI TCCRAC 2 cut(s) 19, 166
MnlI CCTC 5 cut(s) 49, 88, 133, 196, 202
MspR9I CCNGG 2 cut(s) 159, 334
MvaI CCWGG 2 cut(s) 159, 334
NdeI CATATG 1 cut(s) 268
NdeII GATC 3 cut(s) 116, 149, 263
NlaIII CATG 3 cut(s) 140, 281, 323
NlaIV GGNNCC 5 cut(s) 43, 190, 325, 338, 339
NmuCI GTSAC 3 cut(s) 196, 271, 328
PagI TCATGA 2 cut(s) 136, 277
PfeI GAWTC 1 cut(s) 167
PpuMI RGGWCCY 1 cut(s) 337
Psp124BI GAGCTC 2 cut(s) 36, 183
Psp5II RGGWCCY 1 cut(s) 337
Psp6I CCWGG 2 cut(s) 157, 332
PspGI CCWGG 2 cut(s) 157, 332
PspN4I GGNNCC 5 cut(s) 43, 190, 325, 338, 339
PspPI GGNCC 1 cut(s) 337
PspPPI RGGWCCY 1 cut(s) 337
PsuI RGATCY 1 cut(s) 149
SacI GAGCTC 2 cut(s) 36, 183
Sau3AI GATC 3 cut(s) 116, 149, 263
Sau96I GGNCC 1 cut(s) 337
ScrFI CCNGG 2 cut(s) 159, 334
SduI GDGCHC 3 cut(s) 36, 136, 183
SetI ASST 7 cut(s) 16, 36, 144, 163, 183, 198, 246
SinI GGWCC 1 cut(s) 337
Sse9I AATT 2 cut(s) 19, 216
SsiI CCGC 2 cut(s) 59, 206
SspMI CTAG 1 cut(s) 153
SstI GAGCTC 2 cut(s) 36, 183
StyD4I CCNGG 2 cut(s) 157, 332
StyI CCWWGG 2 cut(s) 45, 192
TaaI ACNGT 1 cut(s) 328
TaqI TCGA 3 cut(s) 93, 301, 312
TasI AATT 2 cut(s) 19, 216
TfiI GAWTC 1 cut(s) 167
TseFI GTSAC 3 cut(s) 196, 271, 328
Tsp45I GTSAC 3 cut(s) 196, 271, 328
VpaK11BI GGWCC 1 cut(s) 337
XapI RAATTY 1 cut(s) 19
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.