Rmu_sc0000171.1_g000009

Potato inhibitor I family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000171.1
Physical Location & Seq
Reverse (-)
45255 .. 45571
317 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000171.1_g000009.1.cds

Sequence Viewer

Length: 216 bp
atgtctgatattcaatgcgaaggtaaggattcatggcctgaactgttgggagctgagggaacagttgcaaaggcaacaattgagagcgaaaaccctttagtcgaggcagtgatcgtgctagaaggaacacctgtcactacagatttccggtgtgatagggttcgtgtttgggtcgatacagatggcattgttaccagggtccctgtcattgggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.69

Weight (kDa)

4.22

Isoelectric Point (pI)

23.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000470)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G43570 AT5G43570 AT5G43580
fragaria_vesca FvH4_4g02840 FvH4_4g02850 FvH4_4g02860 FvH4_4g02870 FvH4_4g02880 FvH4_4g02930
malus_domestica MD13G1208300.v1.1 MD13G1208400.v1.1 MD13G1208500.v1.1 MD13G1208700.v1.1 MD16G1210300.v1.1 MD16G1210400.v1.1
prunus_persica Prupe.1G032000_v2.0.a1 Prupe.1G032100_v2.0.a1 Prupe.1G032400_v2.0.a1 Prupe.1G032500_v2.0.a1 Prupe.1G032700_v2.0.a1 Prupe.I000200_v2.0.a1 Prupe.I000300_v2.0.a1
pyrus_communis pycom13g18030 pycom13g18040 pycom13g18050 pycom13g18060 pycom13g18080
rosa_chinensis RchiOBHm_Chr4g0390821 RchiOBHm_Chr4g0390831 RchiOBHm_Chr4g0390841 RchiOBHm_Chr4g0390891 RchiOBHm_Chr4g0390911 RchiOBHm_Chr4g0390921 RchiOBHm_Chr4g0390951 RchiOBHm_Chr4g0390971
rosa_laevigata RLG00000009909
rosa_multiflora Rmu_co8497379.1_g000001 Rmu_sc0000171.1_g000002 Rmu_sc0000171.1_g000003 Rmu_sc0000171.1_g000004 Rmu_sc0000171.1_g000009 Rmu_sc0000171.1_g000010 Rmu_sc0000171.1_g000014 Rmu_sc0000171.1_g000018 Rmu_sc0000171.1_g000019 Rmu_sc0001824.1_g000004 Rmu_sc0016732.1_g000001
rosa_roxburghii Rroxscaffold_5G00336740 Rroxscaffold_5G00336750 Rroxscaffold_5G00336760 Rroxscaffold_5G00336770 Rroxscaffold_5G00336790 Rroxscaffold_5G00336830
rosa_rugosa Rorug03G0331900 Rorug03G0331900 Rorug03G0331900 Rorug03G0332000 Rorug03G0332300 Rorug03G0332500
rosa_samantha Rh4AG033300 Rh4AG033400 Rh4AG033500 Rh4AG033600 Rh4AG033800 Rh4AG034000 Rh4BG027200 Rh4BG027300 Rh4BG027500 Rh4BG027700 Rh4BG027800 Rh4BG028100 Rh4BG028200 Rh4BG028400 Rh4CG036900 Rh4CG037000 Rh4CG037200 Rh4CG037400 Rh4DG030300 Rh4DG030400 Rh4DG030500 Rh4DG030600 Rh4DG030800 Rh4DG031100 Rh4DG031300
rosa_wichuraiana Rw4G002560 Rw4G002580 Rw4G002600 Rw4G002610 Rw4G002620 Rw4G002640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 209
AgsI TTSAA 1 cut(s) 14
AjnI CCWGG 1 cut(s) 194
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
AoxI GGCC 1 cut(s) 35
AspS9I GGNCC 1 cut(s) 199
AvaII GGWCC 1 cut(s) 199
BbvCI CCTCAGC 1 cut(s) 54
BccI CCATC 1 cut(s) 176
BciT130I CCWGG 1 cut(s) 196
BfaI CTAG 1 cut(s) 119
BfmI CTRYAG 1 cut(s) 138
Bme1390I CCNGG 1 cut(s) 196
Bme18I GGWCC 1 cut(s) 199
BmgT120I GGNCC 1 cut(s) 199
BmiI GGNNCC 2 cut(s) 200, 201
BmrFI CCNGG 1 cut(s) 196
Bpu10I CCTNAGC 1 cut(s) 54
BsaJI CCNNGG 1 cut(s) 195
BsaWI WCCGGW 1 cut(s) 147
Bsc4I CCNNNNNNNGG 1 cut(s) 209
BseBI CCWGG 1 cut(s) 196
BseDI CCNNGG 1 cut(s) 195
BseLI CCNNNNNNNGG 1 cut(s) 209
BseMII CTCAG 1 cut(s) 45
BshFI GGCC 1 cut(s) 37
BsiSI CCGG 1 cut(s) 148
BslFI GGGAC 1 cut(s) 185
BslI CCNNNNNNNGG 1 cut(s) 209
BsmFI GGGAC 1 cut(s) 185
BsnI GGCC 1 cut(s) 37
Bsp143I GATC 1 cut(s) 111
BspANI GGCC 1 cut(s) 37
BspCNI CTCAG 1 cut(s) 46
BspLI GGNNCC 2 cut(s) 200, 201
BssECI CCNNGG 1 cut(s) 195
BssMI GATC 1 cut(s) 111
Bst2UI CCWGG 1 cut(s) 196
Bst4CI ACNGT 2 cut(s) 45, 64
BstDEI CTNAG 1 cut(s) 54
BstKTI GATC 1 cut(s) 114
BstMBI GATC 1 cut(s) 111
BstNI CCWGG 1 cut(s) 196
BstSCI CCNGG 1 cut(s) 194
BstSFI CTRYAG 1 cut(s) 138
BsuRI GGCC 1 cut(s) 37
BtsI GCAGTG 1 cut(s) 114
BtsIMutI CAGTG 1 cut(s) 114
Cfr13I GGNCC 1 cut(s) 199
CviAII CATG 1 cut(s) 33
CviJI RGCY 2 cut(s) 37, 53
CviKI_1 RGCY 2 cut(s) 37, 53
DdeI CTNAG 1 cut(s) 54
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
Eco47I GGWCC 1 cut(s) 199
EcoO109I RGGNCCY 1 cut(s) 199
EcoRII CCWGG 1 cut(s) 194
FaeI CATG 1 cut(s) 36
FaiI YATR 1 cut(s) 34
FaqI GGGAC 1 cut(s) 185
FatI CATG 1 cut(s) 32
FspBI CTAG 1 cut(s) 119
HaeIII GGCC 1 cut(s) 37
HapII CCGG 1 cut(s) 148
Hin1II CATG 1 cut(s) 36
HinfI GANTC 1 cut(s) 29
HpaII CCGG 1 cut(s) 148
Hpy188I TCNGA 1 cut(s) 7
HpyAV CCTTC 2 cut(s) 14, 116
HpyCH4III ACNGT 2 cut(s) 45, 64
HpyCH4V TGCA 1 cut(s) 68
HpyF3I CTNAG 1 cut(s) 54
Hsp92II CATG 1 cut(s) 36
KflI GGGWCCC 1 cut(s) 199
Kzo9I GATC 1 cut(s) 111
LmnI GCTCC 1 cut(s) 50
LpnPI CCDG 5 cut(s) 51, 144, 161, 181, 208
MaeI CTAG 1 cut(s) 119
MaeIII GTNAC 2 cut(s) 133, 190
MalI GATC 1 cut(s) 113
MboI GATC 1 cut(s) 111
MfeI CAATTG 1 cut(s) 78
MluCI AATT 1 cut(s) 78
MnlI CCTC 2 cut(s) 49, 97
MspI CCGG 1 cut(s) 148
MspR9I CCNGG 1 cut(s) 196
MunI CAATTG 1 cut(s) 78
MvaI CCWGG 1 cut(s) 196
NdeII GATC 1 cut(s) 111
NlaIII CATG 1 cut(s) 36
NlaIV GGNNCC 2 cut(s) 200, 201
NmuCI GTSAC 1 cut(s) 133
PfeI GAWTC 1 cut(s) 29
PpuMI RGGWCCY 1 cut(s) 199
Psp5II RGGWCCY 1 cut(s) 199
Psp6I CCWGG 1 cut(s) 194
PspGI CCWGG 1 cut(s) 194
PspN4I GGNNCC 2 cut(s) 200, 201
PspPI GGNCC 1 cut(s) 199
PspPPI RGGWCCY 1 cut(s) 199
Sau3AI GATC 1 cut(s) 111
Sau96I GGNCC 1 cut(s) 199
ScrFI CCNGG 1 cut(s) 196
SetI ASST 3 cut(s) 25, 55, 133
SfcI CTRYAG 1 cut(s) 138
SinI GGWCC 1 cut(s) 199
Sse9I AATT 1 cut(s) 78
SspMI CTAG 1 cut(s) 119
StyD4I CCNGG 1 cut(s) 194
TaaI ACNGT 2 cut(s) 45, 64
TaqI TCGA 2 cut(s) 102, 174
TasI AATT 1 cut(s) 78
TfiI GAWTC 1 cut(s) 29
TscAI CASTG 1 cut(s) 114
TseFI GTSAC 1 cut(s) 133
Tsp45I GTSAC 1 cut(s) 133
TspDTI ATGAA 1 cut(s) 21
TspRI CASTG 1 cut(s) 114
VpaK11BI GGWCC 1 cut(s) 199
XspI CTAG 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.