Rh4AG033300

Potato inhibitor I family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
7210504 .. 7213883
3380 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG033300.1

Sequence Viewer

Length: 276 bp
ATGATCGAAGCTGAAATAACTGAGCTATTTACATCTCTGTTACACAGAGATACCAAGCCAGGTGTTTCTGATCCATCTTCATGTAAGGATTCGTGGCCTGAGCTCGTCGGAGCCAAGGCGACAGAGGCGGAGGCAAAAATTGAGAGTGAGAATGATTTAGTCAAGGTTGTCATCGTGAAAGAAGGATCATATGTCACTCATGATTTTCGGTGTAATAGGGTTCGAGTTTGGGTCGATAAACATGGCACCGTCGCCAGGGTCCCCACAAGTGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.07

Weight (kDa)

5.55

Isoelectric Point (pI)

28.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
potato_inhibit PF00280 29 - 91 1.6e-26 Potato inhibitor I family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000470)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G43570 AT5G43570 AT5G43580
fragaria_vesca FvH4_4g02840 FvH4_4g02850 FvH4_4g02860 FvH4_4g02870 FvH4_4g02880 FvH4_4g02930
malus_domestica MD13G1208300.v1.1 MD13G1208400.v1.1 MD13G1208500.v1.1 MD13G1208700.v1.1 MD16G1210300.v1.1 MD16G1210400.v1.1
prunus_persica Prupe.1G032000_v2.0.a1 Prupe.1G032100_v2.0.a1 Prupe.1G032400_v2.0.a1 Prupe.1G032500_v2.0.a1 Prupe.1G032700_v2.0.a1 Prupe.I000200_v2.0.a1 Prupe.I000300_v2.0.a1
pyrus_communis pycom13g18030 pycom13g18040 pycom13g18050 pycom13g18060 pycom13g18080
rosa_chinensis RchiOBHm_Chr4g0390821 RchiOBHm_Chr4g0390831 RchiOBHm_Chr4g0390841 RchiOBHm_Chr4g0390891 RchiOBHm_Chr4g0390911 RchiOBHm_Chr4g0390921 RchiOBHm_Chr4g0390951 RchiOBHm_Chr4g0390971
rosa_laevigata RLG00000009909
rosa_multiflora Rmu_co8497379.1_g000001 Rmu_sc0000171.1_g000002 Rmu_sc0000171.1_g000003 Rmu_sc0000171.1_g000004 Rmu_sc0000171.1_g000009 Rmu_sc0000171.1_g000010 Rmu_sc0000171.1_g000014 Rmu_sc0000171.1_g000018 Rmu_sc0000171.1_g000019 Rmu_sc0001824.1_g000004 Rmu_sc0016732.1_g000001
rosa_roxburghii Rroxscaffold_5G00336740 Rroxscaffold_5G00336750 Rroxscaffold_5G00336760 Rroxscaffold_5G00336770 Rroxscaffold_5G00336790 Rroxscaffold_5G00336830
rosa_rugosa Rorug03G0331900 Rorug03G0331900 Rorug03G0331900 Rorug03G0332000 Rorug03G0332300 Rorug03G0332500
rosa_samantha Rh4AG033300 Rh4AG033400 Rh4AG033500 Rh4AG033600 Rh4AG033800 Rh4AG034000 Rh4BG027200 Rh4BG027300 Rh4BG027500 Rh4BG027700 Rh4BG027800 Rh4BG028100 Rh4BG028200 Rh4BG028400 Rh4CG036900 Rh4CG037000 Rh4CG037200 Rh4CG037400 Rh4DG030300 Rh4DG030400 Rh4DG030500 Rh4DG030600 Rh4DG030800 Rh4DG031100 Rh4DG031300
rosa_wichuraiana Rw4G002560 Rw4G002580 Rw4G002600 Rw4G002610 Rw4G002620 Rw4G002640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 245
AciI CCGC 1 cut(s) 128
AclWI GGATC 2 cut(s) 65, 193
AfiI CCNNNNNNNGG 2 cut(s) 255, 269
AjnI CCWGG 2 cut(s) 58, 254
AluBI AGCT 3 cut(s) 11, 25, 103
AluI AGCT 3 cut(s) 11, 25, 103
Alw21I GWGCWC 1 cut(s) 105
AlwI GGATC 2 cut(s) 65, 193
AoxI GGCC 1 cut(s) 95
AspS9I GGNCC 1 cut(s) 259
AvaII GGWCC 1 cut(s) 259
BanI GGYRCC 1 cut(s) 245
BanII GRGCYC 1 cut(s) 105
Bbv12I GWGCWC 1 cut(s) 105
BccI CCATC 1 cut(s) 82
BciT130I CCWGG 2 cut(s) 60, 256
Bme1390I CCNGG 2 cut(s) 60, 256
Bme18I GGWCC 1 cut(s) 259
BmgT120I GGNCC 1 cut(s) 259
BmiI GGNNCC 4 cut(s) 112, 247, 260, 261
BmrFI CCNGG 2 cut(s) 60, 256
Bpu10I CCTNAGC 1 cut(s) 99
BsaJI CCNNGG 2 cut(s) 114, 255
Bsc4I CCNNNNNNNGG 2 cut(s) 255, 269
BseBI CCWGG 2 cut(s) 60, 256
BseDI CCNNGG 2 cut(s) 114, 255
BseLI CCNNNNNNNGG 2 cut(s) 255, 269
BseMII CTCAG 2 cut(s) 12, 90
BshFI GGCC 1 cut(s) 97
BshNI GGYRCC 1 cut(s) 245
BsiHKAI GWGCWC 1 cut(s) 105
BslFI GGGAC 1 cut(s) 245
BslI CCNNNNNNNGG 2 cut(s) 255, 269
BsmFI GGGAC 1 cut(s) 245
BsnI GGCC 1 cut(s) 97
Bsp1286I GDGCHC 1 cut(s) 105
Bsp143I GATC 3 cut(s) 3, 70, 185
BspACI CCGC 1 cut(s) 128
BspANI GGCC 1 cut(s) 97
BspCNI CTCAG 2 cut(s) 13, 91
BspHI TCATGA 1 cut(s) 199
BspLI GGNNCC 4 cut(s) 112, 247, 260, 261
BspPI GGATC 2 cut(s) 65, 193
BspT107I GGYRCC 1 cut(s) 245
BssECI CCNNGG 2 cut(s) 114, 255
BssMI GATC 3 cut(s) 3, 70, 185
BssT1I CCWWGG 1 cut(s) 114
Bst2UI CCWGG 2 cut(s) 60, 256
Bst4CI ACNGT 1 cut(s) 250
BstDEI CTNAG 2 cut(s) 21, 99
BstKTI GATC 3 cut(s) 6, 73, 188
BstMBI GATC 3 cut(s) 3, 70, 185
BstMWI GCNNNNNNNGC 1 cut(s) 125
BstNI CCWGG 2 cut(s) 60, 256
BstSCI CCNGG 2 cut(s) 58, 254
BsuRI GGCC 1 cut(s) 97
CciI TCATGA 1 cut(s) 199
Cfr13I GGNCC 1 cut(s) 259
CviAII CATG 3 cut(s) 81, 200, 242
CviJI RGCY 6 cut(s) 11, 25, 58, 97, 103, 113
CviKI_1 RGCY 6 cut(s) 11, 25, 58, 97, 103, 113
DdeI CTNAG 2 cut(s) 21, 99
DpnI GATC 3 cut(s) 5, 72, 187
DpnII GATC 3 cut(s) 3, 70, 185
EciI GGCGGA 1 cut(s) 143
Ecl136II GAGCTC 1 cut(s) 103
Eco130I CCWWGG 1 cut(s) 114
Eco24I GRGCYC 1 cut(s) 105
Eco47I GGWCC 1 cut(s) 259
Eco53kI GAGCTC 1 cut(s) 103
EcoICRI GAGCTC 1 cut(s) 103
EcoO109I RGGNCCY 1 cut(s) 259
EcoRII CCWGG 2 cut(s) 58, 254
EcoT14I CCWWGG 1 cut(s) 114
EcoT38I GRGCYC 1 cut(s) 105
ErhI CCWWGG 1 cut(s) 114
FaeI CATG 3 cut(s) 84, 203, 245
FaiI YATR 5 cut(s) 82, 190, 192, 201, 243
FaqI GGGAC 1 cut(s) 245
FatI CATG 3 cut(s) 80, 199, 241
FauNDI CATATG 1 cut(s) 190
FriOI GRGCYC 1 cut(s) 105
HaeIII GGCC 1 cut(s) 97
Hin1II CATG 3 cut(s) 84, 203, 245
HinfI GANTC 1 cut(s) 89
Hpy188I TCNGA 2 cut(s) 70, 110
Hpy188III TCNNGA 2 cut(s) 175, 200
Hpy99I CGWCG 2 cut(s) 110, 254
HpyAV CCTTC 1 cut(s) 176
HpyCH4III ACNGT 1 cut(s) 250
HpyF10VI GCNNNNNNNGC 1 cut(s) 125
HpyF3I CTNAG 2 cut(s) 21, 99
Hsp92II CATG 3 cut(s) 84, 203, 245
KflI GGGWCCC 1 cut(s) 259
Kzo9I GATC 3 cut(s) 3, 70, 185
LmnI GCTCC 1 cut(s) 110
LpnPI CCDG 5 cut(s) 45, 72, 111, 241, 268
MaeIII GTNAC 2 cut(s) 39, 193
MalI GATC 3 cut(s) 5, 72, 187
MboI GATC 3 cut(s) 3, 70, 185
MboII GAAGA 1 cut(s) 69
MhlI GDGCHC 1 cut(s) 105
MluCI AATT 1 cut(s) 138
MmeI TCCRAC 1 cut(s) 88
MnlI CCTC 2 cut(s) 118, 124
MslI CAYNNNNRTG 1 cut(s) 79
MspR9I CCNGG 2 cut(s) 60, 256
MvaI CCWGG 2 cut(s) 60, 256
MwoI GCNNNNNNNGC 1 cut(s) 125
NdeI CATATG 1 cut(s) 190
NdeII GATC 3 cut(s) 3, 70, 185
NlaIII CATG 3 cut(s) 84, 203, 245
NlaIV GGNNCC 4 cut(s) 112, 247, 260, 261
NmuCI GTSAC 1 cut(s) 193
PagI TCATGA 1 cut(s) 199
PfeI GAWTC 1 cut(s) 89
PpuMI RGGWCCY 1 cut(s) 259
Psp124BI GAGCTC 1 cut(s) 105
Psp5II RGGWCCY 1 cut(s) 259
Psp6I CCWGG 2 cut(s) 58, 254
PspGI CCWGG 2 cut(s) 58, 254
PspN4I GGNNCC 4 cut(s) 112, 247, 260, 261
PspPI GGNCC 1 cut(s) 259
PspPPI RGGWCCY 1 cut(s) 259
RseI CAYNNNNRTG 1 cut(s) 79
SacI GAGCTC 1 cut(s) 105
Sau3AI GATC 3 cut(s) 3, 70, 185
Sau96I GGNCC 1 cut(s) 259
ScrFI CCNGG 2 cut(s) 60, 256
SduI GDGCHC 1 cut(s) 105
SetI ASST 5 cut(s) 13, 27, 64, 105, 168
SinI GGWCC 1 cut(s) 259
SmiMI CAYNNNNRTG 1 cut(s) 79
Sse9I AATT 1 cut(s) 138
SsiI CCGC 1 cut(s) 128
SstI GAGCTC 1 cut(s) 105
StyD4I CCNGG 2 cut(s) 58, 254
StyI CCWWGG 1 cut(s) 114
TaaI ACNGT 1 cut(s) 250
TaqI TCGA 3 cut(s) 6, 223, 234
TasI AATT 1 cut(s) 138
TfiI GAWTC 1 cut(s) 89
TseFI GTSAC 1 cut(s) 193
Tsp45I GTSAC 1 cut(s) 193
TspDTI ATGAA 1 cut(s) 69
VpaK11BI GGWCC 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.