Rmu_sc0000171.1_g000014

Potato inhibitor I family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000171.1
Physical Location & Seq
Reverse (-)
67674 .. 67984
311 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000171.1_g000014.1.cds

Sequence Viewer

Length: 213 bp
atgtctgatcaatgcgaaggtaaggattcatggcctgaactgttgggagctgagggaacagttgcaaaggcaacaattgagagagaaaactctttagtagaggcagtgatcgtgctagaaggatcggttgtcactgcagattttcggtgtgatagggttcgtgtttgggtcaatacagctggcattgttaccagggtccctgtcattgggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

7.54

Weight (kDa)

4.58

Isoelectric Point (pI)

19.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000470)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G43570 AT5G43570 AT5G43580
fragaria_vesca FvH4_4g02840 FvH4_4g02850 FvH4_4g02860 FvH4_4g02870 FvH4_4g02880 FvH4_4g02930
malus_domestica MD13G1208300.v1.1 MD13G1208400.v1.1 MD13G1208500.v1.1 MD13G1208700.v1.1 MD16G1210300.v1.1 MD16G1210400.v1.1
prunus_persica Prupe.1G032000_v2.0.a1 Prupe.1G032100_v2.0.a1 Prupe.1G032400_v2.0.a1 Prupe.1G032500_v2.0.a1 Prupe.1G032700_v2.0.a1 Prupe.I000200_v2.0.a1 Prupe.I000300_v2.0.a1
pyrus_communis pycom13g18030 pycom13g18040 pycom13g18050 pycom13g18060 pycom13g18080
rosa_chinensis RchiOBHm_Chr4g0390821 RchiOBHm_Chr4g0390831 RchiOBHm_Chr4g0390841 RchiOBHm_Chr4g0390891 RchiOBHm_Chr4g0390911 RchiOBHm_Chr4g0390921 RchiOBHm_Chr4g0390951 RchiOBHm_Chr4g0390971
rosa_laevigata RLG00000009909
rosa_multiflora Rmu_co8497379.1_g000001 Rmu_sc0000171.1_g000002 Rmu_sc0000171.1_g000003 Rmu_sc0000171.1_g000004 Rmu_sc0000171.1_g000009 Rmu_sc0000171.1_g000010 Rmu_sc0000171.1_g000014 Rmu_sc0000171.1_g000018 Rmu_sc0000171.1_g000019 Rmu_sc0001824.1_g000004 Rmu_sc0016732.1_g000001
rosa_roxburghii Rroxscaffold_5G00336740 Rroxscaffold_5G00336750 Rroxscaffold_5G00336760 Rroxscaffold_5G00336770 Rroxscaffold_5G00336790 Rroxscaffold_5G00336830
rosa_rugosa Rorug03G0331900 Rorug03G0331900 Rorug03G0331900 Rorug03G0332000 Rorug03G0332300 Rorug03G0332500
rosa_samantha Rh4AG033300 Rh4AG033400 Rh4AG033500 Rh4AG033600 Rh4AG033800 Rh4AG034000 Rh4BG027200 Rh4BG027300 Rh4BG027500 Rh4BG027700 Rh4BG027800 Rh4BG028100 Rh4BG028200 Rh4BG028400 Rh4CG036900 Rh4CG037000 Rh4CG037200 Rh4CG037400 Rh4DG030300 Rh4DG030400 Rh4DG030500 Rh4DG030600 Rh4DG030800 Rh4DG031100 Rh4DG031300
rosa_wichuraiana Rw4G002560 Rw4G002580 Rw4G002600 Rw4G002610 Rw4G002620 Rw4G002640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 130
AfiI CCNNNNNNNGG 1 cut(s) 206
AjnI CCWGG 1 cut(s) 191
AluBI AGCT 2 cut(s) 50, 179
AluI AGCT 2 cut(s) 50, 179
AlwI GGATC 1 cut(s) 130
AoxI GGCC 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 196
AvaII GGWCC 1 cut(s) 196
BbvCI CCTCAGC 1 cut(s) 51
BciT130I CCWGG 1 cut(s) 193
BclI TGATCA 1 cut(s) 7
BfaI CTAG 1 cut(s) 116
BfmI CTRYAG 1 cut(s) 135
Bme1390I CCNGG 1 cut(s) 193
Bme18I GGWCC 1 cut(s) 196
BmgT120I GGNCC 1 cut(s) 196
BmiI GGNNCC 2 cut(s) 197, 198
BmrFI CCNGG 1 cut(s) 193
Bpu10I CCTNAGC 1 cut(s) 51
BsaJI CCNNGG 1 cut(s) 192
Bsc4I CCNNNNNNNGG 1 cut(s) 206
BseBI CCWGG 1 cut(s) 193
BseDI CCNNGG 1 cut(s) 192
BseLI CCNNNNNNNGG 1 cut(s) 206
BseMII CTCAG 1 cut(s) 42
BshFI GGCC 1 cut(s) 34
BslFI GGGAC 1 cut(s) 182
BslI CCNNNNNNNGG 1 cut(s) 206
BsmFI GGGAC 1 cut(s) 182
BsnI GGCC 1 cut(s) 34
Bsp143I GATC 3 cut(s) 7, 108, 122
BspANI GGCC 1 cut(s) 34
BspCNI CTCAG 1 cut(s) 43
BspLI GGNNCC 2 cut(s) 197, 198
BspMAI CTGCAG 1 cut(s) 139
BspPI GGATC 1 cut(s) 130
BssECI CCNNGG 1 cut(s) 192
BssMI GATC 3 cut(s) 7, 108, 122
Bst2UI CCWGG 1 cut(s) 193
Bst4CI ACNGT 2 cut(s) 42, 61
BstC8I GCNNGC 1 cut(s) 181
BstDEI CTNAG 1 cut(s) 51
BstKTI GATC 3 cut(s) 10, 111, 125
BstMBI GATC 3 cut(s) 7, 108, 122
BstNI CCWGG 1 cut(s) 193
BstSCI CCNGG 1 cut(s) 191
BstSFI CTRYAG 1 cut(s) 135
BsuRI GGCC 1 cut(s) 34
BtsI GCAGTG 2 cut(s) 111, 132
BtsIMutI CAGTG 2 cut(s) 111, 132
Cac8I GCNNGC 1 cut(s) 181
Cfr13I GGNCC 1 cut(s) 196
CviAII CATG 1 cut(s) 30
CviJI RGCY 3 cut(s) 34, 50, 179
CviKI_1 RGCY 3 cut(s) 34, 50, 179
DdeI CTNAG 1 cut(s) 51
DpnI GATC 3 cut(s) 9, 110, 124
DpnII GATC 3 cut(s) 7, 108, 122
Eco47I GGWCC 1 cut(s) 196
EcoO109I RGGNCCY 1 cut(s) 196
EcoRII CCWGG 1 cut(s) 191
FaeI CATG 1 cut(s) 33
FaiI YATR 1 cut(s) 31
FaqI GGGAC 1 cut(s) 182
FatI CATG 1 cut(s) 29
FbaI TGATCA 1 cut(s) 7
FspBI CTAG 1 cut(s) 116
HaeIII GGCC 1 cut(s) 34
Hin1II CATG 1 cut(s) 33
HinfI GANTC 1 cut(s) 26
Hpy188I TCNGA 1 cut(s) 7
HpyAV CCTTC 2 cut(s) 11, 113
HpyCH4III ACNGT 2 cut(s) 42, 61
HpyCH4V TGCA 2 cut(s) 65, 137
HpyF3I CTNAG 1 cut(s) 51
Hsp92II CATG 1 cut(s) 33
KflI GGGWCCC 1 cut(s) 196
Ksp22I TGATCA 1 cut(s) 7
Kzo9I GATC 3 cut(s) 7, 108, 122
LmnI GCTCC 1 cut(s) 47
LpnPI CCDG 4 cut(s) 48, 165, 178, 205
MaeI CTAG 1 cut(s) 116
MaeIII GTNAC 2 cut(s) 130, 187
MalI GATC 3 cut(s) 9, 110, 124
MboI GATC 3 cut(s) 7, 108, 122
MfeI CAATTG 1 cut(s) 75
MluCI AATT 1 cut(s) 75
MnlI CCTC 2 cut(s) 46, 94
MspA1I CMGCKG 1 cut(s) 179
MspR9I CCNGG 1 cut(s) 193
MunI CAATTG 1 cut(s) 75
MvaI CCWGG 1 cut(s) 193
NdeII GATC 3 cut(s) 7, 108, 122
NlaIII CATG 1 cut(s) 33
NlaIV GGNNCC 2 cut(s) 197, 198
NmuCI GTSAC 1 cut(s) 130
PfeI GAWTC 1 cut(s) 26
PpuMI RGGWCCY 1 cut(s) 196
Psp5II RGGWCCY 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 191
PspGI CCWGG 1 cut(s) 191
PspN4I GGNNCC 2 cut(s) 197, 198
PspPI GGNCC 1 cut(s) 196
PspPPI RGGWCCY 1 cut(s) 196
PstI CTGCAG 1 cut(s) 139
PvuII CAGCTG 1 cut(s) 179
Sau3AI GATC 3 cut(s) 7, 108, 122
Sau96I GGNCC 1 cut(s) 196
ScrFI CCNGG 1 cut(s) 193
SetI ASST 3 cut(s) 22, 52, 181
SfcI CTRYAG 1 cut(s) 135
SgeI CNNG 8 cut(s) 42, 47, 124, 128, 173, 192, 204, 205
SinI GGWCC 1 cut(s) 196
Sse9I AATT 1 cut(s) 75
SspMI CTAG 1 cut(s) 116
StyD4I CCNGG 1 cut(s) 191
TaaI ACNGT 2 cut(s) 42, 61
TasI AATT 1 cut(s) 75
TfiI GAWTC 1 cut(s) 26
TscAI CASTG 2 cut(s) 111, 139
TseFI GTSAC 1 cut(s) 130
Tsp45I GTSAC 1 cut(s) 130
TspDTI ATGAA 1 cut(s) 18
TspRI CASTG 2 cut(s) 111, 139
VpaK11BI GGWCC 1 cut(s) 196
XspI CTAG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.