Rmu_sc0001824.1_g000004

Glu S.griseus protease inhibitor-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001824.1
OG0000470
Physical Location & Seq
Forward (+)
9028 .. 9363
336 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001824.1_g000004.1.cds

Sequence Viewer

Length: 219 bp
atgggttcagaatgtgaaggtaaaggttcatggccggagcttgttggagagcatggggaggttgccaaagggaaaattgagagagagaaccctaatgtgactgctaggattgtagttgacggagaaatgtacgtcattaccgactacgattgctttagggtttgggtttgggttgacaaagacgatggaactgtcgtaaaaactccgattatcggttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
potato_inhibit

Protein Analysis

72

Amino Acids

8.01

Weight (kDa)

4.55

Isoelectric Point (pI)

8.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000470)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G43570 AT5G43570 AT5G43580
fragaria_vesca FvH4_4g02840 FvH4_4g02850 FvH4_4g02860 FvH4_4g02870 FvH4_4g02880 FvH4_4g02930
malus_domestica MD13G1208300.v1.1 MD13G1208400.v1.1 MD13G1208500.v1.1 MD13G1208700.v1.1 MD16G1210300.v1.1 MD16G1210400.v1.1
prunus_persica Prupe.1G032000_v2.0.a1 Prupe.1G032100_v2.0.a1 Prupe.1G032400_v2.0.a1 Prupe.1G032500_v2.0.a1 Prupe.1G032700_v2.0.a1 Prupe.I000200_v2.0.a1 Prupe.I000300_v2.0.a1
pyrus_communis pycom13g18030 pycom13g18040 pycom13g18050 pycom13g18060 pycom13g18080
rosa_chinensis RchiOBHm_Chr4g0390821 RchiOBHm_Chr4g0390831 RchiOBHm_Chr4g0390841 RchiOBHm_Chr4g0390891 RchiOBHm_Chr4g0390911 RchiOBHm_Chr4g0390921 RchiOBHm_Chr4g0390951 RchiOBHm_Chr4g0390971
rosa_laevigata RLG00000009909
rosa_multiflora Rmu_co8497379.1_g000001 Rmu_sc0000171.1_g000002 Rmu_sc0000171.1_g000003 Rmu_sc0000171.1_g000004 Rmu_sc0000171.1_g000009 Rmu_sc0000171.1_g000010 Rmu_sc0000171.1_g000014 Rmu_sc0000171.1_g000018 Rmu_sc0000171.1_g000019 Rmu_sc0001824.1_g000004 Rmu_sc0016732.1_g000001
rosa_roxburghii Rroxscaffold_5G00336740 Rroxscaffold_5G00336750 Rroxscaffold_5G00336760 Rroxscaffold_5G00336770 Rroxscaffold_5G00336790 Rroxscaffold_5G00336830
rosa_rugosa Rorug03G0331900 Rorug03G0331900 Rorug03G0331900 Rorug03G0332000 Rorug03G0332300 Rorug03G0332500
rosa_samantha Rh4AG033300 Rh4AG033400 Rh4AG033500 Rh4AG033600 Rh4AG033800 Rh4AG034000 Rh4BG027200 Rh4BG027300 Rh4BG027500 Rh4BG027700 Rh4BG027800 Rh4BG028100 Rh4BG028200 Rh4BG028400 Rh4CG036900 Rh4CG037000 Rh4CG037200 Rh4CG037400 Rh4DG030300 Rh4DG030400 Rh4DG030500 Rh4DG030600 Rh4DG030800 Rh4DG031100 Rh4DG031300
rosa_wichuraiana Rw4G002560 Rw4G002580 Rw4G002600 Rw4G002610 Rw4G002620 Rw4G002640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 32
AfaI GTAC 1 cut(s) 131
AfiI CCNNNNNNNGG 1 cut(s) 212
AluBI AGCT 1 cut(s) 40
AluI AGCT 1 cut(s) 40
AoxI GGCC 1 cut(s) 32
BccI CCATC 1 cut(s) 179
BfaI CTAG 1 cut(s) 105
Bsc4I CCNNNNNNNGG 1 cut(s) 212
BseLI CCNNNNNNNGG 1 cut(s) 212
BshFI GGCC 1 cut(s) 34
BsiSI CCGG 1 cut(s) 35
BslI CCNNNNNNNGG 1 cut(s) 212
BsnI GGCC 1 cut(s) 34
BspANI GGCC 1 cut(s) 34
Bst4CI ACNGT 1 cut(s) 193
BsuRI GGCC 1 cut(s) 34
Csp6I GTAC 1 cut(s) 130
CviAII CATG 2 cut(s) 30, 53
CviJI RGCY 2 cut(s) 34, 40
CviKI_1 RGCY 2 cut(s) 34, 40
CviQI GTAC 1 cut(s) 130
EaeI YGGCCR 1 cut(s) 32
FaeI CATG 2 cut(s) 33, 56
FaiI YATR 2 cut(s) 31, 54
FatI CATG 2 cut(s) 29, 52
FspBI CTAG 1 cut(s) 105
HaeIII GGCC 1 cut(s) 34
HapII CCGG 1 cut(s) 35
Hin1II CATG 2 cut(s) 33, 56
HincII GTYRAC 2 cut(s) 118, 175
HindII GTYRAC 2 cut(s) 118, 175
HpaII CCGG 1 cut(s) 35
Hpy166II GTNNAC 2 cut(s) 118, 175
Hpy188I TCNGA 2 cut(s) 10, 207
Hpy8I GTNNAC 2 cut(s) 118, 175
HpyAV CCTTC 1 cut(s) 11
HpyCH4III ACNGT 1 cut(s) 193
HpyCH4IV ACGT 1 cut(s) 132
HpySE526I ACGT 1 cut(s) 132
Hsp92II CATG 2 cut(s) 33, 56
LmnI GCTCC 1 cut(s) 37
LpnPI CCDG 1 cut(s) 48
MaeI CTAG 1 cut(s) 105
MaeII ACGT 1 cut(s) 132
MaeIII GTNAC 1 cut(s) 97
MluCI AATT 1 cut(s) 75
MmeI TCCRAC 1 cut(s) 25
MnlI CCTC 1 cut(s) 52
MseI TTAA 1 cut(s) 217
MspI CCGG 1 cut(s) 35
NlaIII CATG 2 cut(s) 33, 56
NmuCI GTSAC 1 cut(s) 97
PcsI WCGNNNNNNNCGW 1 cut(s) 138
RsaI GTAC 1 cut(s) 131
RsaNI GTAC 1 cut(s) 130
SaqAI TTAA 1 cut(s) 217
SetI ASST 5 cut(s) 22, 28, 42, 63, 135
SgeI CNNG 5 cut(s) 42, 47, 53, 65, 117
Sse9I AATT 1 cut(s) 75
SspMI CTAG 1 cut(s) 105
TaaI ACNGT 1 cut(s) 193
TaiI ACGT 1 cut(s) 135
TasI AATT 1 cut(s) 75
Tru1I TTAA 1 cut(s) 217
Tru9I TTAA 1 cut(s) 217
TseFI GTSAC 1 cut(s) 97
Tsp45I GTSAC 1 cut(s) 97
TspDTI ATGAA 1 cut(s) 18
TspGWI ACGGA 1 cut(s) 135
XspI CTAG 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.