pycom13g18050

Potato inhibitor I family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
OG0000470
Physical Location & Seq
Forward (+)
14041643 .. 14041855
213 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g18050.1

Sequence Viewer

Length: 213 bp
ATGTCATCTGAATGTGAAGGGAAGGATTCATGGCCTGAGCTCGTTGGAGCCAAGGGGACAGAGGCGGAGGCAACCATCGAGAGTGAGAATCATTTAGTCAATGCTGTGATTGTGAAAGAAGGAATGTTTGTCACTGCAGATTTTCGATGTGATAGGGTTCGAGTTTGGGTCAATAAACGTGGTATTGTTACCAGGGTCCCTGTAATTGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
potato_inhibit

Protein Analysis

71

Amino Acids

7.72

Weight (kDa)

5.29

Isoelectric Point (pI)

45.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
potato_inhibit PF00280 8 - 70 1.3e-26 Potato inhibitor I family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000470)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G43570 AT5G43570 AT5G43580
fragaria_vesca FvH4_4g02840 FvH4_4g02850 FvH4_4g02860 FvH4_4g02870 FvH4_4g02880 FvH4_4g02930
malus_domestica MD13G1208300.v1.1 MD13G1208400.v1.1 MD13G1208500.v1.1 MD13G1208700.v1.1 MD16G1210300.v1.1 MD16G1210400.v1.1
prunus_persica Prupe.1G032000_v2.0.a1 Prupe.1G032100_v2.0.a1 Prupe.1G032400_v2.0.a1 Prupe.1G032500_v2.0.a1 Prupe.1G032700_v2.0.a1 Prupe.I000200_v2.0.a1 Prupe.I000300_v2.0.a1
pyrus_communis pycom13g18030 pycom13g18040 pycom13g18050 pycom13g18060 pycom13g18080
rosa_chinensis RchiOBHm_Chr4g0390821 RchiOBHm_Chr4g0390831 RchiOBHm_Chr4g0390841 RchiOBHm_Chr4g0390891 RchiOBHm_Chr4g0390911 RchiOBHm_Chr4g0390921 RchiOBHm_Chr4g0390951 RchiOBHm_Chr4g0390971
rosa_laevigata RLG00000009909
rosa_multiflora Rmu_co8497379.1_g000001 Rmu_sc0000171.1_g000002 Rmu_sc0000171.1_g000003 Rmu_sc0000171.1_g000004 Rmu_sc0000171.1_g000009 Rmu_sc0000171.1_g000010 Rmu_sc0000171.1_g000014 Rmu_sc0000171.1_g000018 Rmu_sc0000171.1_g000019 Rmu_sc0001824.1_g000004 Rmu_sc0016732.1_g000001
rosa_roxburghii Rroxscaffold_5G00336740 Rroxscaffold_5G00336750 Rroxscaffold_5G00336760 Rroxscaffold_5G00336770 Rroxscaffold_5G00336790 Rroxscaffold_5G00336830
rosa_rugosa Rorug03G0331900 Rorug03G0331900 Rorug03G0331900 Rorug03G0332000 Rorug03G0332300 Rorug03G0332500
rosa_samantha Rh4AG033300 Rh4AG033400 Rh4AG033500 Rh4AG033600 Rh4AG033800 Rh4AG034000 Rh4BG027200 Rh4BG027300 Rh4BG027500 Rh4BG027700 Rh4BG027800 Rh4BG028100 Rh4BG028200 Rh4BG028400 Rh4CG036900 Rh4CG037000 Rh4CG037200 Rh4CG037400 Rh4DG030300 Rh4DG030400 Rh4DG030500 Rh4DG030600 Rh4DG030800 Rh4DG031100 Rh4DG031300
rosa_wichuraiana Rw4G002560 Rw4G002580 Rw4G002600 Rw4G002610 Rw4G002620 Rw4G002640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 65
AfiI CCNNNNNNNGG 1 cut(s) 206
AjnI CCWGG 1 cut(s) 191
AluBI AGCT 1 cut(s) 40
AluI AGCT 1 cut(s) 40
Alw21I GWGCWC 1 cut(s) 42
AoxI GGCC 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 196
AvaII GGWCC 1 cut(s) 196
BanII GRGCYC 1 cut(s) 42
Bbv12I GWGCWC 1 cut(s) 42
BccI CCATC 1 cut(s) 83
BciT130I CCWGG 1 cut(s) 193
BfmI CTRYAG 1 cut(s) 135
Bme1390I CCNGG 1 cut(s) 193
Bme18I GGWCC 1 cut(s) 196
BmgT120I GGNCC 1 cut(s) 196
BmiI GGNNCC 3 cut(s) 49, 197, 198
BmrFI CCNGG 1 cut(s) 193
Bpu10I CCTNAGC 1 cut(s) 36
BsaJI CCNNGG 2 cut(s) 51, 192
Bsc4I CCNNNNNNNGG 1 cut(s) 206
BseBI CCWGG 1 cut(s) 193
BseDI CCNNGG 2 cut(s) 51, 192
BseLI CCNNNNNNNGG 1 cut(s) 206
BseMII CTCAG 1 cut(s) 27
BshFI GGCC 1 cut(s) 34
BsiHKAI GWGCWC 1 cut(s) 42
BslFI GGGAC 2 cut(s) 70, 182
BslI CCNNNNNNNGG 1 cut(s) 206
BsmFI GGGAC 2 cut(s) 70, 182
BsnI GGCC 1 cut(s) 34
Bsp1286I GDGCHC 1 cut(s) 42
BspACI CCGC 1 cut(s) 65
BspANI GGCC 1 cut(s) 34
BspCNI CTCAG 1 cut(s) 28
BspLI GGNNCC 3 cut(s) 49, 197, 198
BspMAI CTGCAG 1 cut(s) 139
BssECI CCNNGG 2 cut(s) 51, 192
BssT1I CCWWGG 1 cut(s) 51
Bst2UI CCWGG 1 cut(s) 193
BstDEI CTNAG 1 cut(s) 36
BstNI CCWGG 1 cut(s) 193
BstSCI CCNGG 1 cut(s) 191
BstSFI CTRYAG 1 cut(s) 135
BsuRI GGCC 1 cut(s) 34
BtsI GCAGTG 1 cut(s) 132
BtsIMutI CAGTG 1 cut(s) 132
Cfr13I GGNCC 1 cut(s) 196
CspCI CAANNNNNGTGG 2 cut(s) 160, 195
CviAII CATG 1 cut(s) 30
CviJI RGCY 3 cut(s) 34, 40, 50
CviKI_1 RGCY 3 cut(s) 34, 40, 50
DdeI CTNAG 1 cut(s) 36
EciI GGCGGA 1 cut(s) 80
Ecl136II GAGCTC 1 cut(s) 40
Eco130I CCWWGG 1 cut(s) 51
Eco24I GRGCYC 1 cut(s) 42
Eco47I GGWCC 1 cut(s) 196
Eco53kI GAGCTC 1 cut(s) 40
EcoICRI GAGCTC 1 cut(s) 40
EcoO109I RGGNCCY 1 cut(s) 196
EcoRII CCWGG 1 cut(s) 191
EcoT14I CCWWGG 1 cut(s) 51
EcoT38I GRGCYC 1 cut(s) 42
ErhI CCWWGG 1 cut(s) 51
FaeI CATG 1 cut(s) 33
FaiI YATR 1 cut(s) 31
FaqI GGGAC 2 cut(s) 70, 182
FatI CATG 1 cut(s) 29
FriOI GRGCYC 1 cut(s) 42
HaeIII GGCC 1 cut(s) 34
Hin1II CATG 1 cut(s) 33
HinfI GANTC 2 cut(s) 26, 88
Hpy188I TCNGA 1 cut(s) 10
Hpy188III TCNNGA 1 cut(s) 79
HpyAV CCTTC 3 cut(s) 11, 16, 113
HpyCH4IV ACGT 1 cut(s) 178
HpyCH4V TGCA 1 cut(s) 137
HpyF3I CTNAG 1 cut(s) 36
HpySE526I ACGT 1 cut(s) 178
Hsp92II CATG 1 cut(s) 33
KflI GGGWCCC 1 cut(s) 196
LmnI GCTCC 1 cut(s) 47
LpnPI CCDG 3 cut(s) 48, 178, 205
MaeII ACGT 1 cut(s) 178
MaeIII GTNAC 2 cut(s) 130, 187
MhlI GDGCHC 1 cut(s) 42
MluCI AATT 1 cut(s) 204
MmeI TCCRAC 1 cut(s) 25
MnlI CCTC 2 cut(s) 55, 61
MseI TTAA 1 cut(s) 211
MslI CAYNNNNRTG 1 cut(s) 10
MspR9I CCNGG 1 cut(s) 193
MvaI CCWGG 1 cut(s) 193
NlaIII CATG 1 cut(s) 33
NlaIV GGNNCC 3 cut(s) 49, 197, 198
NmuCI GTSAC 1 cut(s) 130
PfeI GAWTC 2 cut(s) 26, 88
PpuMI RGGWCCY 1 cut(s) 196
Psp124BI GAGCTC 1 cut(s) 42
Psp5II RGGWCCY 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 191
PspGI CCWGG 1 cut(s) 191
PspN4I GGNNCC 3 cut(s) 49, 197, 198
PspPI GGNCC 1 cut(s) 196
PspPPI RGGWCCY 1 cut(s) 196
PstI CTGCAG 1 cut(s) 139
RseI CAYNNNNRTG 1 cut(s) 10
SacI GAGCTC 1 cut(s) 42
SaqAI TTAA 1 cut(s) 211
Sau96I GGNCC 1 cut(s) 196
ScrFI CCNGG 1 cut(s) 193
SduI GDGCHC 1 cut(s) 42
SetI ASST 2 cut(s) 42, 181
SfcI CTRYAG 1 cut(s) 135
SgeI CNNG 9 cut(s) 42, 47, 53, 64, 91, 173, 191, 204, 205
SinI GGWCC 1 cut(s) 196
SmiMI CAYNNNNRTG 1 cut(s) 10
Sse9I AATT 1 cut(s) 204
SsiI CCGC 1 cut(s) 65
SstI GAGCTC 1 cut(s) 42
StyD4I CCNGG 1 cut(s) 191
StyI CCWWGG 1 cut(s) 51
TaiI ACGT 1 cut(s) 181
TaqI TCGA 3 cut(s) 78, 145, 160
TasI AATT 1 cut(s) 204
TfiI GAWTC 2 cut(s) 26, 88
Tru1I TTAA 1 cut(s) 211
Tru9I TTAA 1 cut(s) 211
TscAI CASTG 1 cut(s) 139
TseFI GTSAC 1 cut(s) 130
Tsp45I GTSAC 1 cut(s) 130
TspDTI ATGAA 1 cut(s) 18
TspRI CASTG 1 cut(s) 139
VpaK11BI GGWCC 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.