Rmu_sc0000171.1_g000018

Potato inhibitor I family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000171.1
Physical Location & Seq
Reverse (-)
77755 .. 78071
317 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000171.1_g000018.1.cds

Sequence Viewer

Length: 219 bp
atggctgatcaatgcgaaggtaaggattcatggcctgaactgttgggagctcaggggacagttgcaaaggaaacaattgagagcgaaaactctttagtcaaggcagagatagtgctagaaggaacaattgtccctgctgatttccggagacagtgtgatagggttcgtgtttgggtcgatacagatggcattgttaccagggtccctgtcattgggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

7.9

Weight (kDa)

4.5

Isoelectric Point (pI)

31.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000470)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G43570 AT5G43570 AT5G43580
fragaria_vesca FvH4_4g02840 FvH4_4g02850 FvH4_4g02860 FvH4_4g02870 FvH4_4g02880 FvH4_4g02930
malus_domestica MD13G1208300.v1.1 MD13G1208400.v1.1 MD13G1208500.v1.1 MD13G1208700.v1.1 MD16G1210300.v1.1 MD16G1210400.v1.1
prunus_persica Prupe.1G032000_v2.0.a1 Prupe.1G032100_v2.0.a1 Prupe.1G032400_v2.0.a1 Prupe.1G032500_v2.0.a1 Prupe.1G032700_v2.0.a1 Prupe.I000200_v2.0.a1 Prupe.I000300_v2.0.a1
pyrus_communis pycom13g18030 pycom13g18040 pycom13g18050 pycom13g18060 pycom13g18080
rosa_chinensis RchiOBHm_Chr4g0390821 RchiOBHm_Chr4g0390831 RchiOBHm_Chr4g0390841 RchiOBHm_Chr4g0390891 RchiOBHm_Chr4g0390911 RchiOBHm_Chr4g0390921 RchiOBHm_Chr4g0390951 RchiOBHm_Chr4g0390971
rosa_laevigata RLG00000009909
rosa_multiflora Rmu_co8497379.1_g000001 Rmu_sc0000171.1_g000002 Rmu_sc0000171.1_g000003 Rmu_sc0000171.1_g000004 Rmu_sc0000171.1_g000009 Rmu_sc0000171.1_g000010 Rmu_sc0000171.1_g000014 Rmu_sc0000171.1_g000018 Rmu_sc0000171.1_g000019 Rmu_sc0001824.1_g000004 Rmu_sc0016732.1_g000001
rosa_roxburghii Rroxscaffold_5G00336740 Rroxscaffold_5G00336750 Rroxscaffold_5G00336760 Rroxscaffold_5G00336770 Rroxscaffold_5G00336790 Rroxscaffold_5G00336830
rosa_rugosa Rorug03G0331900 Rorug03G0331900 Rorug03G0331900 Rorug03G0332000 Rorug03G0332300 Rorug03G0332500
rosa_samantha Rh4AG033300 Rh4AG033400 Rh4AG033500 Rh4AG033600 Rh4AG033800 Rh4AG034000 Rh4BG027200 Rh4BG027300 Rh4BG027500 Rh4BG027700 Rh4BG027800 Rh4BG028100 Rh4BG028200 Rh4BG028400 Rh4CG036900 Rh4CG037000 Rh4CG037200 Rh4CG037400 Rh4DG030300 Rh4DG030400 Rh4DG030500 Rh4DG030600 Rh4DG030800 Rh4DG031100 Rh4DG031300
rosa_wichuraiana Rw4G002560 Rw4G002580 Rw4G002600 Rw4G002610 Rw4G002620 Rw4G002640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 144
AfiI CCNNNNNNNGG 1 cut(s) 212
AjnI CCWGG 1 cut(s) 197
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
Alw21I GWGCWC 1 cut(s) 52
Alw26I GTCTC 1 cut(s) 142
Aor13HI TCCGGA 1 cut(s) 144
AoxI GGCC 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 202
AvaII GGWCC 1 cut(s) 202
BanII GRGCYC 1 cut(s) 52
Bbv12I GWGCWC 1 cut(s) 52
BccI CCATC 1 cut(s) 179
BciT130I CCWGG 1 cut(s) 199
BclI TGATCA 1 cut(s) 7
BcoDI GTCTC 1 cut(s) 142
BfaI CTAG 1 cut(s) 116
Bme1390I CCNGG 1 cut(s) 199
Bme18I GGWCC 1 cut(s) 202
BmgT120I GGNCC 1 cut(s) 202
BmiI GGNNCC 2 cut(s) 203, 204
BmrFI CCNGG 1 cut(s) 199
Bpu10I CCTNAGC 1 cut(s) 51
BsaJI CCNNGG 1 cut(s) 198
BsaWI WCCGGW 1 cut(s) 144
BsaXI ACNNNNNCTCC 2 cut(s) 139, 169
Bsc4I CCNNNNNNNGG 1 cut(s) 212
BseAI TCCGGA 1 cut(s) 144
BseBI CCWGG 1 cut(s) 199
BseDI CCNNGG 1 cut(s) 198
BseLI CCNNNNNNNGG 1 cut(s) 212
BseMII CTCAG 1 cut(s) 65
BshFI GGCC 1 cut(s) 34
BsiHKAI GWGCWC 1 cut(s) 52
BsiSI CCGG 1 cut(s) 145
BslFI GGGAC 3 cut(s) 70, 116, 188
BslI CCNNNNNNNGG 1 cut(s) 212
BsmAI GTCTC 1 cut(s) 142
BsmFI GGGAC 3 cut(s) 70, 116, 188
BsnI GGCC 1 cut(s) 34
Bsp1286I GDGCHC 1 cut(s) 52
Bsp13I TCCGGA 1 cut(s) 144
Bsp143I GATC 1 cut(s) 7
BspANI GGCC 1 cut(s) 34
BspCNI CTCAG 1 cut(s) 64
BspEI TCCGGA 1 cut(s) 144
BspLI GGNNCC 2 cut(s) 203, 204
BssECI CCNNGG 1 cut(s) 198
BssMI GATC 1 cut(s) 7
Bst2UI CCWGG 1 cut(s) 199
Bst4CI ACNGT 3 cut(s) 42, 61, 153
BstDEI CTNAG 1 cut(s) 51
BstKTI GATC 1 cut(s) 10
BstMAI GTCTC 1 cut(s) 142
BstMBI GATC 1 cut(s) 7
BstNI CCWGG 1 cut(s) 199
BstSCI CCNGG 1 cut(s) 197
BsuRI GGCC 1 cut(s) 34
BtsIMutI CAGTG 1 cut(s) 158
Cfr13I GGNCC 1 cut(s) 202
CviAII CATG 1 cut(s) 30
CviJI RGCY 3 cut(s) 5, 34, 50
CviKI_1 RGCY 3 cut(s) 5, 34, 50
DdeI CTNAG 1 cut(s) 51
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
Ecl136II GAGCTC 1 cut(s) 50
Eco24I GRGCYC 1 cut(s) 52
Eco47I GGWCC 1 cut(s) 202
Eco53kI GAGCTC 1 cut(s) 50
EcoICRI GAGCTC 1 cut(s) 50
EcoO109I RGGNCCY 1 cut(s) 202
EcoRII CCWGG 1 cut(s) 197
EcoT38I GRGCYC 1 cut(s) 52
FaeI CATG 1 cut(s) 33
FaiI YATR 1 cut(s) 31
FaqI GGGAC 3 cut(s) 70, 116, 188
FatI CATG 1 cut(s) 29
FbaI TGATCA 1 cut(s) 7
FriOI GRGCYC 1 cut(s) 52
FspBI CTAG 1 cut(s) 116
HaeIII GGCC 1 cut(s) 34
HapII CCGG 1 cut(s) 145
Hin1II CATG 1 cut(s) 33
HinfI GANTC 1 cut(s) 26
HpaII CCGG 1 cut(s) 145
Hpy188III TCNNGA 1 cut(s) 145
HpyAV CCTTC 2 cut(s) 11, 113
HpyCH4III ACNGT 3 cut(s) 42, 61, 153
HpyCH4V TGCA 1 cut(s) 65
HpyF3I CTNAG 1 cut(s) 51
Hsp92II CATG 1 cut(s) 33
KflI GGGWCCC 1 cut(s) 202
Kpn2I TCCGGA 1 cut(s) 144
Ksp22I TGATCA 1 cut(s) 7
Kzo9I GATC 1 cut(s) 7
LmnI GCTCC 1 cut(s) 47
LpnPI CCDG 6 cut(s) 38, 48, 147, 158, 184, 211
MaeI CTAG 1 cut(s) 116
MaeIII GTNAC 1 cut(s) 193
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MfeI CAATTG 2 cut(s) 75, 126
MhlI GDGCHC 1 cut(s) 52
MluCI AATT 2 cut(s) 75, 126
MroI TCCGGA 1 cut(s) 144
MspI CCGG 1 cut(s) 145
MspR9I CCNGG 1 cut(s) 199
MunI CAATTG 2 cut(s) 75, 126
MvaI CCWGG 1 cut(s) 199
NdeII GATC 1 cut(s) 7
NlaIII CATG 1 cut(s) 33
NlaIV GGNNCC 2 cut(s) 203, 204
PfeI GAWTC 1 cut(s) 26
PpuMI RGGWCCY 1 cut(s) 202
Psp124BI GAGCTC 1 cut(s) 52
Psp5II RGGWCCY 1 cut(s) 202
Psp6I CCWGG 1 cut(s) 197
PspGI CCWGG 1 cut(s) 197
PspN4I GGNNCC 2 cut(s) 203, 204
PspPI GGNCC 1 cut(s) 202
PspPPI RGGWCCY 1 cut(s) 202
SacI GAGCTC 1 cut(s) 52
Sau3AI GATC 1 cut(s) 7
Sau96I GGNCC 1 cut(s) 202
ScrFI CCNGG 1 cut(s) 199
SduI GDGCHC 1 cut(s) 52
SetI ASST 2 cut(s) 22, 52
SinI GGWCC 1 cut(s) 202
Sse9I AATT 2 cut(s) 75, 126
SspMI CTAG 1 cut(s) 116
SstI GAGCTC 1 cut(s) 52
StyD4I CCNGG 1 cut(s) 197
TaaI ACNGT 3 cut(s) 42, 61, 153
TaqI TCGA 1 cut(s) 177
TasI AATT 2 cut(s) 75, 126
TfiI GAWTC 1 cut(s) 26
TscAI CASTG 1 cut(s) 158
TspDTI ATGAA 1 cut(s) 18
TspRI CASTG 1 cut(s) 158
VpaK11BI GGWCC 1 cut(s) 202
XspI CTAG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.