RchiOBHm_Chr4g0390911

Potato inhibitor I family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
6209372 .. 6209620
249 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36383

Sequence Viewer

Length: 249 bp
ATGCGGTGTGTAGGTAAGGATTCGTGGCCTGAGCTCGTCGGAGCCAAGGCGACAAAGACGGAGGCAAAAATTGAGAGCGAGAATGATTTAGTCAAGGTTGTCATGGTGAAAGAAGGATCATATGTCATTGATGATTTTCGATGTAATAGGGTTCGAGTTTGGGTCGATAAACAATTAAACACGGCACCGTCACCAGGGTCCCCACAAGTGGTTGAATTTAGTCTCTTAGGGTATTTCAAGGTTATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.2

Weight (kDa)

7.74

Isoelectric Point (pI)

27.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
potato_inhibit PF00280 6 - 58 4.5e-20 Potato inhibitor I family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000470)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G43570 AT5G43570 AT5G43580
fragaria_vesca FvH4_4g02840 FvH4_4g02850 FvH4_4g02860 FvH4_4g02870 FvH4_4g02880 FvH4_4g02930
malus_domestica MD13G1208300.v1.1 MD13G1208400.v1.1 MD13G1208500.v1.1 MD13G1208700.v1.1 MD16G1210300.v1.1 MD16G1210400.v1.1
prunus_persica Prupe.1G032000_v2.0.a1 Prupe.1G032100_v2.0.a1 Prupe.1G032400_v2.0.a1 Prupe.1G032500_v2.0.a1 Prupe.1G032700_v2.0.a1 Prupe.I000200_v2.0.a1 Prupe.I000300_v2.0.a1
pyrus_communis pycom13g18030 pycom13g18040 pycom13g18050 pycom13g18060 pycom13g18080
rosa_chinensis RchiOBHm_Chr4g0390821 RchiOBHm_Chr4g0390831 RchiOBHm_Chr4g0390841 RchiOBHm_Chr4g0390891 RchiOBHm_Chr4g0390911 RchiOBHm_Chr4g0390921 RchiOBHm_Chr4g0390951 RchiOBHm_Chr4g0390971
rosa_laevigata RLG00000009909
rosa_multiflora Rmu_co8497379.1_g000001 Rmu_sc0000171.1_g000002 Rmu_sc0000171.1_g000003 Rmu_sc0000171.1_g000004 Rmu_sc0000171.1_g000009 Rmu_sc0000171.1_g000010 Rmu_sc0000171.1_g000014 Rmu_sc0000171.1_g000018 Rmu_sc0000171.1_g000019 Rmu_sc0001824.1_g000004 Rmu_sc0016732.1_g000001
rosa_roxburghii Rroxscaffold_5G00336740 Rroxscaffold_5G00336750 Rroxscaffold_5G00336760 Rroxscaffold_5G00336770 Rroxscaffold_5G00336790 Rroxscaffold_5G00336830
rosa_rugosa Rorug03G0331900 Rorug03G0331900 Rorug03G0331900 Rorug03G0332000 Rorug03G0332300 Rorug03G0332500
rosa_samantha Rh4AG033300 Rh4AG033400 Rh4AG033500 Rh4AG033600 Rh4AG033800 Rh4AG034000 Rh4BG027200 Rh4BG027300 Rh4BG027500 Rh4BG027700 Rh4BG027800 Rh4BG028100 Rh4BG028200 Rh4BG028400 Rh4CG036900 Rh4CG037000 Rh4CG037200 Rh4CG037400 Rh4DG030300 Rh4DG030400 Rh4DG030500 Rh4DG030600 Rh4DG030800 Rh4DG031100 Rh4DG031300
rosa_wichuraiana Rw4G002560 Rw4G002580 Rw4G002600 Rw4G002610 Rw4G002620 Rw4G002640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 184
AciI CCGC 1 cut(s) 4
AclWI GGATC 1 cut(s) 124
AcsI RAATTY 1 cut(s) 215
AfiI CCNNNNNNNGG 2 cut(s) 194, 208
AgsI TTSAA 2 cut(s) 215, 238
AjnI CCWGG 1 cut(s) 193
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
Alw21I GWGCWC 1 cut(s) 36
Alw26I GTCTC 1 cut(s) 227
AlwI GGATC 1 cut(s) 124
AoxI GGCC 1 cut(s) 26
ApoI RAATTY 1 cut(s) 215
AspS9I GGNCC 1 cut(s) 198
AsuHPI GGTGA 2 cut(s) 118, 183
AvaII GGWCC 1 cut(s) 198
BanI GGYRCC 1 cut(s) 184
BanII GRGCYC 1 cut(s) 36
Bbv12I GWGCWC 1 cut(s) 36
BceAI ACGGC 1 cut(s) 198
BciT130I CCWGG 1 cut(s) 195
BcoDI GTCTC 1 cut(s) 227
Bme1390I CCNGG 1 cut(s) 195
Bme18I GGWCC 1 cut(s) 198
BmgT120I GGNCC 1 cut(s) 198
BmiI GGNNCC 4 cut(s) 43, 186, 199, 200
BmrFI CCNGG 1 cut(s) 195
Bpu10I CCTNAGC 1 cut(s) 30
BsaJI CCNNGG 2 cut(s) 45, 194
Bsc4I CCNNNNNNNGG 2 cut(s) 194, 208
BseBI CCWGG 1 cut(s) 195
BseDI CCNNGG 2 cut(s) 45, 194
BseLI CCNNNNNNNGG 2 cut(s) 194, 208
BseMII CTCAG 1 cut(s) 21
BshFI GGCC 1 cut(s) 28
BshNI GGYRCC 1 cut(s) 184
BsiHKAI GWGCWC 1 cut(s) 36
BslFI GGGAC 1 cut(s) 184
BslI CCNNNNNNNGG 2 cut(s) 194, 208
BsmAI GTCTC 1 cut(s) 227
BsmFI GGGAC 1 cut(s) 184
BsnI GGCC 1 cut(s) 28
Bsp1286I GDGCHC 1 cut(s) 36
Bsp143I GATC 1 cut(s) 116
BspACI CCGC 1 cut(s) 4
BspANI GGCC 1 cut(s) 28
BspCNI CTCAG 1 cut(s) 22
BspLI GGNNCC 4 cut(s) 43, 186, 199, 200
BspPI GGATC 1 cut(s) 124
BspT107I GGYRCC 1 cut(s) 184
BssECI CCNNGG 2 cut(s) 45, 194
BssMI GATC 1 cut(s) 116
BssT1I CCWWGG 1 cut(s) 45
Bst2UI CCWGG 1 cut(s) 195
Bst4CI ACNGT 1 cut(s) 189
BstDEI CTNAG 2 cut(s) 30, 226
BstKTI GATC 1 cut(s) 119
BstMAI GTCTC 1 cut(s) 227
BstMBI GATC 1 cut(s) 116
BstNI CCWGG 1 cut(s) 195
BstSCI CCNGG 1 cut(s) 193
BsuRI GGCC 1 cut(s) 28
Cfr13I GGNCC 1 cut(s) 198
CviAII CATG 1 cut(s) 103
CviJI RGCY 3 cut(s) 28, 34, 44
CviKI_1 RGCY 3 cut(s) 28, 34, 44
DdeI CTNAG 2 cut(s) 30, 226
DpnI GATC 1 cut(s) 118
DpnII GATC 1 cut(s) 116
Ecl136II GAGCTC 1 cut(s) 34
Eco130I CCWWGG 1 cut(s) 45
Eco24I GRGCYC 1 cut(s) 36
Eco47I GGWCC 1 cut(s) 198
Eco53kI GAGCTC 1 cut(s) 34
EcoICRI GAGCTC 1 cut(s) 34
EcoO109I RGGNCCY 1 cut(s) 198
EcoRII CCWGG 1 cut(s) 193
EcoT14I CCWWGG 1 cut(s) 45
EcoT38I GRGCYC 1 cut(s) 36
ErhI CCWWGG 1 cut(s) 45
FaeI CATG 1 cut(s) 106
FaiI YATR 3 cut(s) 104, 121, 123
FaqI GGGAC 1 cut(s) 184
FatI CATG 1 cut(s) 102
FauNDI CATATG 1 cut(s) 121
FriOI GRGCYC 1 cut(s) 36
HaeIII GGCC 1 cut(s) 28
Hin1II CATG 1 cut(s) 106
HinfI GANTC 1 cut(s) 20
HphI GGTGA 2 cut(s) 118, 183
Hpy188I TCNGA 1 cut(s) 41
Hpy99I CGWCG 1 cut(s) 41
HpyAV CCTTC 1 cut(s) 107
HpyCH4III ACNGT 1 cut(s) 189
HpyF3I CTNAG 2 cut(s) 30, 226
Hsp92II CATG 1 cut(s) 106
KflI GGGWCCC 1 cut(s) 198
Kzo9I GATC 1 cut(s) 116
LmnI GCTCC 1 cut(s) 41
LpnPI CCDG 3 cut(s) 42, 180, 207
MaeIII GTNAC 1 cut(s) 189
MalI GATC 1 cut(s) 118
MboI GATC 1 cut(s) 116
MhlI GDGCHC 1 cut(s) 36
MluCI AATT 3 cut(s) 69, 173, 215
MmeI TCCRAC 1 cut(s) 19
MnlI CCTC 1 cut(s) 55
MseI TTAA 2 cut(s) 176, 247
MspR9I CCNGG 1 cut(s) 195
MvaI CCWGG 1 cut(s) 195
NdeI CATATG 1 cut(s) 121
NdeII GATC 1 cut(s) 116
NlaIII CATG 1 cut(s) 106
NlaIV GGNNCC 4 cut(s) 43, 186, 199, 200
NmuCI GTSAC 1 cut(s) 189
PfeI GAWTC 1 cut(s) 20
PpuMI RGGWCCY 1 cut(s) 198
Psp124BI GAGCTC 1 cut(s) 36
Psp5II RGGWCCY 1 cut(s) 198
Psp6I CCWGG 1 cut(s) 193
PspGI CCWGG 1 cut(s) 193
PspN4I GGNNCC 4 cut(s) 43, 186, 199, 200
PspPI GGNCC 1 cut(s) 198
PspPPI RGGWCCY 1 cut(s) 198
SacI GAGCTC 1 cut(s) 36
SaqAI TTAA 2 cut(s) 176, 247
Sau3AI GATC 1 cut(s) 116
Sau96I GGNCC 1 cut(s) 198
ScrFI CCNGG 1 cut(s) 195
SduI GDGCHC 1 cut(s) 36
SetI ASST 4 cut(s) 16, 36, 99, 243
SinI GGWCC 1 cut(s) 198
Sse9I AATT 3 cut(s) 69, 173, 215
SsiI CCGC 1 cut(s) 4
SstI GAGCTC 1 cut(s) 36
StyD4I CCNGG 1 cut(s) 193
StyI CCWWGG 1 cut(s) 45
TaaI ACNGT 1 cut(s) 189
TaqI TCGA 3 cut(s) 139, 154, 165
TasI AATT 3 cut(s) 69, 173, 215
TfiI GAWTC 1 cut(s) 20
Tru1I TTAA 2 cut(s) 176, 247
Tru9I TTAA 2 cut(s) 176, 247
TseFI GTSAC 1 cut(s) 189
Tsp45I GTSAC 1 cut(s) 189
TspGWI ACGGA 1 cut(s) 74
VpaK11BI GGWCC 1 cut(s) 198
XapI RAATTY 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.