pycom17g15180

aspartic-type endopeptidase activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
13021086 .. 13021436
351 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g15180.1

Sequence Viewer

Length: 351 bp
ATGGGTCTTAATCTCACAAGCAGTCTAGGAATAACAATGATAAGGCCAATCGTCATGAAGCAGAAAACAAATTGCGTTTATTTCCTCAACTACACGTTTACTAAATCCTTAGTGACAACAATCGGTGGCCCAACGCCATTAATAGAAGGGCATAGCAAAGCCCAACTCGTGTTGCCCAATGGTACTTTGTTTACCATCAACGAAATCTTATATTCTCCTCATTTTAGTCGAACATTGTTTAATTTTAAAGACATTCGAGCTAACAAATTCCATTATGAAACCATGGAAGAAAGTGGAGAGCTTTTTATAGCTGTTTTCATAGGACGACTTATGTTGCTTTTACCTAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

117

Amino Acids

13.1

Weight (kDa)

9.21

Isoelectric Point (pI)

32.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 266
AfaI GTAC 1 cut(s) 184
AflIII ACRYGT 1 cut(s) 93
AluBI AGCT 4 cut(s) 260, 301, 311, 348
AluI AGCT 4 cut(s) 260, 301, 311, 348
AoxI GGCC 2 cut(s) 44, 127
ApoI RAATTY 1 cut(s) 266
AseI ATTAAT 1 cut(s) 140
AspS9I GGNCC 1 cut(s) 128
BauI CACGAG 1 cut(s) 167
BccI CCATC 1 cut(s) 203
BfaI CTAG 3 cut(s) 26, 345, 349
BmgT120I GGNCC 1 cut(s) 128
BsaJI CCNNGG 1 cut(s) 282
BseDI CCNNGG 1 cut(s) 282
BseRI GAGGAG 1 cut(s) 207
BshFI GGCC 2 cut(s) 46, 129
BsnI GGCC 2 cut(s) 46, 129
Bsp19I CCATGG 1 cut(s) 282
BspANI GGCC 2 cut(s) 46, 129
BspHI TCATGA 1 cut(s) 54
BssECI CCNNGG 1 cut(s) 282
BssSI CACGAG 1 cut(s) 167
BssT1I CCWWGG 1 cut(s) 282
Bst2BI CACGAG 1 cut(s) 167
BstDEI CTNAG 1 cut(s) 109
BstDSI CCRYGG 1 cut(s) 282
BsuRI GGCC 2 cut(s) 46, 129
BtgI CCRYGG 1 cut(s) 282
CciI TCATGA 1 cut(s) 54
Cfr13I GGNCC 1 cut(s) 128
Csp6I GTAC 1 cut(s) 183
CviAII CATG 2 cut(s) 55, 283
CviJI RGCY 7 cut(s) 46, 129, 161, 260, 301, 311, 348
CviKI_1 RGCY 7 cut(s) 46, 129, 161, 260, 301, 311, 348
CviQI GTAC 1 cut(s) 183
DdeI CTNAG 1 cut(s) 109
DraI TTTAAA 1 cut(s) 247
Eco130I CCWWGG 1 cut(s) 282
EcoT14I CCWWGG 1 cut(s) 282
ErhI CCWWGG 1 cut(s) 282
FaeI CATG 2 cut(s) 58, 286
FaiI YATR 8 cut(s) 56, 153, 211, 276, 284, 308, 320, 332
FatI CATG 2 cut(s) 54, 282
FspBI CTAG 3 cut(s) 26, 345, 349
HaeIII GGCC 2 cut(s) 46, 129
Hin1II CATG 2 cut(s) 58, 286
Hpy166II GTNNAC 2 cut(s) 99, 192
Hpy188III TCNNGA 1 cut(s) 55
Hpy8I GTNNAC 2 cut(s) 99, 192
HpyAV CCTTC 1 cut(s) 140
HpyCH4IV ACGT 1 cut(s) 95
HpyF3I CTNAG 1 cut(s) 109
HpySE526I ACGT 1 cut(s) 95
Hsp92II CATG 2 cut(s) 58, 286
MaeI CTAG 3 cut(s) 26, 345, 349
MaeII ACGT 1 cut(s) 95
MaeIII GTNAC 1 cut(s) 112
MboII GAAGA 1 cut(s) 299
MluCI AATT 3 cut(s) 70, 241, 266
MnlI CCTC 2 cut(s) 95, 228
MseI TTAA 4 cut(s) 9, 140, 240, 246
NcoI CCATGG 1 cut(s) 282
NlaIII CATG 2 cut(s) 58, 286
NmuCI GTSAC 1 cut(s) 112
PagI TCATGA 1 cut(s) 54
PshBI ATTAAT 1 cut(s) 140
PspPI GGNCC 1 cut(s) 128
RsaI GTAC 1 cut(s) 184
RsaNI GTAC 1 cut(s) 183
SaqAI TTAA 4 cut(s) 9, 140, 240, 246
Sau96I GGNCC 1 cut(s) 128
SetI ASST 6 cut(s) 98, 262, 303, 313, 346, 350
SgeI CNNG 8 cut(s) 30, 38, 67, 106, 179, 181, 269, 295
Sse9I AATT 3 cut(s) 70, 241, 266
SspMI CTAG 3 cut(s) 26, 345, 349
StyI CCWWGG 1 cut(s) 282
TaiI ACGT 1 cut(s) 98
TaqI TCGA 2 cut(s) 229, 256
TasI AATT 3 cut(s) 70, 241, 266
Tru1I TTAA 4 cut(s) 9, 140, 240, 246
Tru9I TTAA 4 cut(s) 9, 140, 240, 246
TseFI GTSAC 1 cut(s) 112
Tsp45I GTSAC 1 cut(s) 112
TspDTI ATGAA 3 cut(s) 71, 291, 307
VspI ATTAAT 1 cut(s) 140
XapI RAATTY 1 cut(s) 266
XspI CTAG 3 cut(s) 26, 345, 349
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.