Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004583.1

Orthogroup ID

OG0002041

Physical Location & Seq

Genomic Coordinates Reverse (-)

51708 .. 54261

Gene Structure 2554 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004583.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 834 bp

atggattttggagaactacaatgtcttgcggatagtgcgactacgcaaaccattctccgccataggcaattattcttggagatgttgcctacatattcctctgtgactatgatggctgggccatcaggattggttcaaggacatggaatggtccaatttctcttgccaaatggcaccttcactaatgtcgcaaaagctctctacgctcttaaggaaaatcgcaccttattgagctctaaagatatcagagccaacggatttcatgtggaaacgcatacagagaacggaaaagagttcctttacattaccgctaatgattgcggacggaaacacttcttagagaagcttatgtgtcaatctagtagactttatgtcactacaattcgacctattgaatccaataatggagtgcagacccttatcctgccacctattgctcgaaacctatttggcactccaaccatgcacaaacctcgtcgtcctgttgtgatcaagcatgatgaccttaggcctaaagcatcaaacaatgccttagccttaattcctgtggaacaggcacaatctgttgtcaagagaaagtgcccatcatcaccatatacgtttgatcaagatcaagcctcttcagcccttgatcatctgtcgtcttcaagttgtcaacaaagcaaagcttctaccaagttcttcatcaagctcgtggagaatcaacaagcgctaagcacacttgccgattcatccaccatcaaatctaaagaacactcaccacgtgacatcggtcgtggttcaaatctgatcaagagcaaatctctgcatcccttgatcaaccgccttctataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_2 rve

Protein Analysis

277

Amino Acids

30.75

Weight (kDa)

9.55

Isoelectric Point (pI)

44.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002041)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g06723 FvH4_4g13932 FvH4_6g39332 FvH4_7g15611
pyrus_communis	pycom13g23550 pycom17g15180 pycom17g15210
rosa_chinensis	RchiOBHm_Chr1g0343001 RchiOBHm_Chr6g0295561
rosa_multiflora	Rmu_sc0000087.1_g000020 Rmu_sc0000161.1_g000059 Rmu_sc0000315.1_g000062 Rmu_sc0000588.1_g000018 Rmu_sc0000817.1_g000004 Rmu_sc0000982.1_g000052 Rmu_sc0001336.1_g000012 Rmu_sc0001913.1_g000050 Rmu_sc0002906.1_g000006 Rmu_sc0003044.1_g000025 Rmu_sc0003522.1_g000052 Rmu_sc0003628.1_g000013 Rmu_sc0003669.1_g000016 Rmu_sc0003758.1_g000007 Rmu_sc0003916.1_g000014 Rmu_sc0003941.1_g000008 Rmu_sc0004191.1_g000059 Rmu_sc0004298.1_g000020 Rmu_sc0004583.1_g000013 Rmu_sc0004890.1_g000015 Rmu_sc0004928.1_g000023 Rmu_sc0005187.1_g000007 Rmu_sc0006382.1_g000026 Rmu_sc0007727.1_g000008 Rmu_sc0007986.1_g000007 Rmu_sc0008198.1_g000008 Rmu_sc0010103.1_g000003 Rmu_sc0014117.1_g000002 Rmu_ssc0000141.1_g000015 Rmu_ssc0000295.1_g000027 Rmu_ssc0000442.1_g000036
rosa_roxburghii	Rroxscaffold_1G00042140 Rroxscaffold_3G00237020 Rroxscaffold_4G00323050 Rroxscaffold_4G00329660
rosa_wichuraiana	Rw1G031230

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	173
AccI	GTMKAC	1 cut(s)	364
AciI	CCGC	5 cut(s)	29, 58, 309, 321, 823
AcuI	CTGAAG	1 cut(s)	606
AcvI	CACGTG	1 cut(s)	764
AdeI	CACNNNGTG	1 cut(s)	764
AfeI	AGCGCT	1 cut(s)	711
AflII	CTTAAG	1 cut(s)	209
AgsI	TTSAA	4 cut(s)	137, 395, 648, 783
AhdI	GACNNNNNGTC	1 cut(s)	371
AluBI	AGCT	5 cut(s)	197, 234, 346, 668, 691
AluI	AGCT	5 cut(s)	197, 234, 346, 668, 691
Alw21I	GWGCWC	1 cut(s)	236
Aor51HI	AGCGCT	1 cut(s)	711
AoxI	GGCC	2 cut(s)	119, 509
Asp700I	GAANNNNTTC	1 cut(s)	332
AspLEI	GCGC	1 cut(s)	712
AspS9I	GGNCC	2 cut(s)	119, 151
AsuHPI	GGTGA	2 cut(s)	582, 750
AvaII	GGWCC	1 cut(s)	151
AxyI	CCTNAGG	1 cut(s)	506
BaeGI	GKGCMC	1 cut(s)	584
BanI	GGYRCC	1 cut(s)	173
BanII	GRGCYC	1 cut(s)	236
BauI	CACGAG	1 cut(s)	692
BbrPI	CACGTG	1 cut(s)	764
BbsI	GAAGAC	1 cut(s)	636
Bbv12I	GWGCWC	1 cut(s)	236
BccI	CCATC	4 cut(s)	106, 130, 592, 746
BcgI	CGANNNNNNTGC	2 cut(s)	455, 489
BclI	TGATCA	5 cut(s)	489, 604, 631, 789, 816
BfaI	CTAG	1 cut(s)	360
BfoI	RGCGCY	1 cut(s)	713
BfrI	CTTAAG	1 cut(s)	209
BlpI	GCTNAGC	1 cut(s)	713
Bme18I	GGWCC	1 cut(s)	151
BmeRI	GACNNNNNGTC	1 cut(s)	371
BmgT120I	GGNCC	2 cut(s)	119, 151
BmiI	GGNNCC	1 cut(s)	175
BmsI	GCATC	2 cut(s)	527, 817
BoxI	GACNNNNGTC	1 cut(s)	771
BpiI	GAAGAC	1 cut(s)	636
BplI	GAGNNNNNCTC	2 cut(s)	787, 819
Bpu10I	CCTNAGC	1 cut(s)	532
Bpu1102I	GCTNAGC	1 cut(s)	713
BsaAI	YACGTR	1 cut(s)	764
BsaBI	GATNNNNATC	1 cut(s)	609
Bse21I	CCTNAGG	1 cut(s)	506
Bse8I	GATNNNNATC	1 cut(s)	609
BseGI	GGATG	2 cut(s)	731, 808
BseJI	GATNNNNATC	1 cut(s)	609
BseSI	GKGCMC	1 cut(s)	584
BseYI	CCCAGC	1 cut(s)	116
BsgI	GTGCAG	1 cut(s)	431
Bsh1285I	CGRYCG	1 cut(s)	775
BshFI	GGCC	2 cut(s)	121, 511
BshNI	GGYRCC	1 cut(s)	173
BsiEI	CGRYCG	1 cut(s)	775
BsiHKAI	GWGCWC	1 cut(s)	236
BsnI	GGCC	2 cut(s)	121, 511
Bsp1286I	GDGCHC	2 cut(s)	236, 584
Bsp143I	GATC	6 cut(s)	489, 604, 610, 631, 789, 816
Bsp1720I	GCTNAGC	1 cut(s)	713
BspACI	CCGC	5 cut(s)	29, 58, 309, 321, 823
BspANI	GGCC	2 cut(s)	121, 511
BspLI	GGNNCC	1 cut(s)	175
BspT107I	GGYRCC	1 cut(s)	173
BspTI	CTTAAG	1 cut(s)	209
BssMI	GATC	6 cut(s)	489, 604, 610, 631, 789, 816
BssSI	CACGAG	1 cut(s)	692
Bst2BI	CACGAG	1 cut(s)	692
Bst6I	CTCTTC	1 cut(s)	625
BstAFI	CTTAAG	1 cut(s)	209
BstBAI	YACGTR	1 cut(s)	764
BstDEI	CTNAG	4 cut(s)	337, 506, 532, 713
BstF5I	GGATG	2 cut(s)	731, 808
BstH2I	RGCGCY	1 cut(s)	713
BstHHI	GCGC	1 cut(s)	712
BstKTI	GATC	6 cut(s)	492, 607, 613, 634, 792, 819
BstMBI	GATC	6 cut(s)	489, 604, 610, 631, 789, 816
BstMCI	CGRYCG	1 cut(s)	775
BstMWI	GCNNNNNNNGC	3 cut(s)	35, 203, 623
BstPAI	GACNNNNGTC	1 cut(s)	771
BstSLI	GKGCMC	1 cut(s)	584
BstV2I	GAAGAC	1 cut(s)	636
Bsu36I	CCTNAGG	1 cut(s)	506
BsuRI	GGCC	2 cut(s)	121, 511
BtsCI	GGATG	2 cut(s)	731, 808
CfoI	GCGC	1 cut(s)	712
Cfr13I	GGNCC	2 cut(s)	119, 151
CviAII	CATG	4 cut(s)	143, 263, 463, 497
DdeI	CTNAG	4 cut(s)	337, 506, 532, 713
DpnI	GATC	6 cut(s)	491, 606, 612, 633, 791, 818
DpnII	GATC	6 cut(s)	489, 604, 610, 631, 789, 816
DraIII	CACNNNGTG	1 cut(s)	764
DriI	GACNNNNNGTC	1 cut(s)	371
Eam1104I	CTCTTC	1 cut(s)	625
Eam1105I	GACNNNNNGTC	1 cut(s)	371
EarI	CTCTTC	1 cut(s)	625
EciI	GGCGGA	1 cut(s)	47
Ecl136II	GAGCTC	1 cut(s)	234
Eco147I	AGGCCT	1 cut(s)	511
Eco24I	GRGCYC	1 cut(s)	236
Eco32I	GATATC	1 cut(s)	244
Eco47I	GGWCC	1 cut(s)	151
Eco47III	AGCGCT	1 cut(s)	711
Eco53kI	GAGCTC	1 cut(s)	234
Eco57I	CTGAAG	1 cut(s)	606
Eco72I	CACGTG	1 cut(s)	764
Eco81I	CCTNAGG	1 cut(s)	506
EcoICRI	GAGCTC	1 cut(s)	234
EcoRV	GATATC	1 cut(s)	244
EcoT38I	GRGCYC	1 cut(s)	236
FaeI	CATG	4 cut(s)	146, 266, 466, 500
FalI	AAGNNNNNCTT	4 cut(s)	282, 314, 652, 684
FatI	CATG	4 cut(s)	142, 262, 462, 496
FbaI	TGATCA	5 cut(s)	489, 604, 631, 789, 816
FblI	GTMKAC	1 cut(s)	364
FokI	GGATG	2 cut(s)	718, 795
FriOI	GRGCYC	1 cut(s)	236
FspBI	CTAG	1 cut(s)	360
GlaI	GCGC	1 cut(s)	711
GsaI	CCCAGC	1 cut(s)	120
HaeII	RGCGCY	1 cut(s)	713
HaeIII	GGCC	2 cut(s)	121, 511
HhaI	GCGC	1 cut(s)	712
Hin1II	CATG	4 cut(s)	146, 266, 466, 500
Hin6I	GCGC	1 cut(s)	710
HinP1I	GCGC	1 cut(s)	710
HincII	GTYRAC	1 cut(s)	656
HindII	GTYRAC	1 cut(s)	656
HindIII	AAGCTT	2 cut(s)	344, 666
HinfI	GANTC	3 cut(s)	395, 700, 728
HphI	GGTGA	2 cut(s)	582, 750
Hpy166II	GTNNAC	2 cut(s)	365, 656
Hpy188I	TCNGA	2 cut(s)	248, 789
Hpy188III	TCNNGA	4 cut(s)	126, 571, 608, 793
Hpy8I	GTNNAC	2 cut(s)	365, 656
Hpy99I	CGWCG	1 cut(s)	480
HpyAV	CCTTC	1 cut(s)	187
HpyCH4IV	ACGT	2 cut(s)	599, 763
HpyCH4V	TGCA	3 cut(s)	412, 466, 808
HpyF10VI	GCNNNNNNNGC	3 cut(s)	35, 203, 623
HpyF3I	CTNAG	4 cut(s)	337, 506, 532, 713
HpySE526I	ACGT	2 cut(s)	599, 763
Hsp92II	CATG	4 cut(s)	146, 266, 466, 500
HspAI	GCGC	1 cut(s)	710
Ksp22I	TGATCA	5 cut(s)	489, 604, 631, 789, 816
Kzo9I	GATC	6 cut(s)	489, 604, 610, 631, 789, 816
LpnPI	CCDG	6 cut(s)	102, 111, 437, 495, 539, 558
LweI	GCATC	2 cut(s)	527, 817
MaeI	CTAG	1 cut(s)	360
MaeII	ACGT	2 cut(s)	599, 763
MaeIII	GTNAC	3 cut(s)	103, 373, 764
MalI	GATC	6 cut(s)	491, 606, 612, 633, 791, 818
MboI	GATC	6 cut(s)	489, 604, 610, 631, 789, 816
MboII	GAAGA	3 cut(s)	612, 636, 673
MhlI	GDGCHC	2 cut(s)	236, 584
MluCI	AATT	4 cut(s)	68, 155, 381, 540
MmeI	TCCRAC	1 cut(s)	482
MnlI	CCTC	3 cut(s)	109, 483, 628
MroXI	GAANNNNTTC	1 cut(s)	332
MseI	TTAA	2 cut(s)	210, 539
MspCI	CTTAAG	1 cut(s)	209
MwoI	GCNNNNNNNGC	3 cut(s)	35, 203, 623
NdeII	GATC	6 cut(s)	489, 604, 610, 631, 789, 816
NlaIII	CATG	4 cut(s)	146, 266, 466, 500
NlaIV	GGNNCC	1 cut(s)	175
NmuCI	GTSAC	3 cut(s)	103, 373, 764
PceI	AGGCCT	1 cut(s)	511
PdmI	GAANNNNTTC	1 cut(s)	332
PfeI	GAWTC	3 cut(s)	395, 700, 728
PmaCI	CACGTG	1 cut(s)	764
PmlI	CACGTG	1 cut(s)	764
Ppu21I	YACGTR	1 cut(s)	764
PshAI	GACNNNNGTC	1 cut(s)	771
Psp124BI	GAGCTC	1 cut(s)	236
PspCI	CACGTG	1 cut(s)	764
PspFI	CCCAGC	1 cut(s)	116
PspN4I	GGNNCC	1 cut(s)	175
PspPI	GGNCC	2 cut(s)	119, 151
SacI	GAGCTC	1 cut(s)	236
SaqAI	TTAA	2 cut(s)	210, 539
Sau3AI	GATC	6 cut(s)	489, 604, 610, 631, 789, 816
Sau96I	GGNCC	2 cut(s)	119, 151
SduI	GDGCHC	2 cut(s)	236, 584
SfaNI	GCATC	2 cut(s)	527, 817
SinI	GGWCC	1 cut(s)	151
SmlI	CTYRAG	1 cut(s)	209
SmoI	CTYRAG	1 cut(s)	209
Sse9I	AATT	4 cut(s)	68, 155, 381, 540
SseBI	AGGCCT	1 cut(s)	511
SsiI	CCGC	5 cut(s)	29, 58, 309, 321, 823
SspMI	CTAG	1 cut(s)	360
SstI	GAGCTC	1 cut(s)	236
StuI	AGGCCT	1 cut(s)	511
TaiI	ACGT	2 cut(s)	602, 766
TaqI	TCGA	2 cut(s)	385, 439
TaqII	GACCGA	1 cut(s)	761
TasI	AATT	4 cut(s)	68, 155, 381, 540
TfiI	GAWTC	3 cut(s)	395, 700, 728
Tru1I	TTAA	2 cut(s)	210, 539
Tru9I	TTAA	2 cut(s)	210, 539
TseFI	GTSAC	3 cut(s)	103, 373, 764
Tsp45I	GTSAC	3 cut(s)	103, 373, 764
TspDTI	ATGAA	3 cut(s)	251, 673, 720
TspGWI	ACGGA	3 cut(s)	270, 300, 340
Vha464I	CTTAAG	1 cut(s)	209
VpaK11BI	GGWCC	1 cut(s)	151
XmiI	GTMKAC	1 cut(s)	364
XmnI	GAANNNNTTC	1 cut(s)	332
XspI	CTAG	1 cut(s)	360

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.