Rmu_sc0007727.1_g000008

aspartic-type endopeptidase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007727.1
Physical Location & Seq
Reverse (-)
34564 .. 36524
1961 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007727.1_g000008.1.cds

Sequence Viewer

Length: 612 bp
atggatactggagaacttcaatgtctcgcgtatagtgtgactacgcacaccattctccgtcatagacaattattcctagagatgttgcctacatattcctatgtgactatgatgactgggccatcaagtttagttcaaggacatggaatggcccaatttcttttccccaatggcaccttgatcacaatcgtagaagctctctacactcctagggaaaatcaaatcctattgacctttaaagatattcgagccaacggattccatgcagaaatgcatactgagaacggaaaaaggaacgacagaaattgtcgtggcctgtccctactatgtctcatctcaatccccgttgaagtgatgagatcacacggaggtaggcatggccccaacgctatagattacggcactctggcatcacaggccatggcctcagctaggatgcatgggaggcctgtggagcctattcttgagaatatagagatctctgaaaattacactagtatacatgagacatgggatagaaactccaatatcattgatgatgtattcgctcaattcattgggcatgagattgttgggtccgatgatatcaaaccacgctcctttgatgaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

203

Amino Acids

22.85

Weight (kDa)

5.64

Isoelectric Point (pI)

37.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 173
AccI GTMKAC 1 cut(s) 499
AccII CGCG 1 cut(s) 29
AfiI CCNNNNNNNGG 1 cut(s) 432
AgsI TTSAA 3 cut(s) 20, 137, 350
AhlI ACTAGT 1 cut(s) 494
AluBI AGCT 2 cut(s) 197, 431
AluI AGCT 2 cut(s) 197, 431
Alw26I GTCTC 3 cut(s) 29, 335, 500
AoxI GGCC 7 cut(s) 119, 150, 313, 379, 417, 423, 446
AspA2I CCTAGG 1 cut(s) 209
AspS9I GGNCC 4 cut(s) 119, 151, 380, 576
AvaII GGWCC 1 cut(s) 576
AvrII CCTAGG 1 cut(s) 209
BanI GGYRCC 1 cut(s) 173
BbvCI CCTCAGC 1 cut(s) 427
BccI CCATC 1 cut(s) 130
BceAI ACGGC 1 cut(s) 415
BclI TGATCA 1 cut(s) 180
BcoDI GTCTC 3 cut(s) 29, 335, 500
BcuI ACTAGT 1 cut(s) 494
BfaI CTAG 4 cut(s) 77, 210, 432, 495
BfmI CTRYAG 1 cut(s) 390
BglII AGATCT 1 cut(s) 477
BlnI CCTAGG 1 cut(s) 209
Bme18I GGWCC 1 cut(s) 576
BmgT120I GGNCC 4 cut(s) 119, 151, 380, 576
BmiI GGNNCC 4 cut(s) 175, 382, 456, 577
BmrI ACTGGG 1 cut(s) 126
BmsI GCATC 2 cut(s) 419, 426
BmuI ACTGGG 1 cut(s) 126
BpmI CTGGAG 1 cut(s) 30
Bpu10I CCTNAGC 1 cut(s) 427
BpuEI CTTGAG 1 cut(s) 485
BsaBI GATNNNNATC 1 cut(s) 185
BsaJI CCNNGG 2 cut(s) 209, 420
Bsc4I CCNNNNNNNGG 1 cut(s) 432
Bse1I ACTGG 2 cut(s) 13, 121
Bse8I GATNNNNATC 1 cut(s) 185
BseDI CCNNGG 2 cut(s) 209, 420
BseGI GGATG 1 cut(s) 441
BseJI GATNNNNATC 1 cut(s) 185
BseLI CCNNNNNNNGG 1 cut(s) 432
BseMII CTCAG 2 cut(s) 270, 441
BseNI ACTGG 2 cut(s) 13, 121
Bsh1236I CGCG 1 cut(s) 29
BshFI GGCC 7 cut(s) 121, 152, 315, 381, 419, 425, 448
BshNI GGYRCC 1 cut(s) 173
BslFI GGGAC 1 cut(s) 304
BslI CCNNNNNNNGG 1 cut(s) 432
BsmAI GTCTC 3 cut(s) 29, 335, 500
BsmFI GGGAC 1 cut(s) 304
BsnI GGCC 7 cut(s) 121, 152, 315, 381, 419, 425, 448
Bsp143I GATC 3 cut(s) 180, 359, 477
Bsp19I CCATGG 1 cut(s) 420
BspANI GGCC 7 cut(s) 121, 152, 315, 381, 419, 425, 448
BspCNI CTCAG 2 cut(s) 271, 440
BspFNI CGCG 1 cut(s) 29
BspLI GGNNCC 4 cut(s) 175, 382, 456, 577
BspT107I GGYRCC 1 cut(s) 173
BsrI ACTGG 2 cut(s) 13, 121
BssECI CCNNGG 2 cut(s) 209, 420
BssMI GATC 3 cut(s) 180, 359, 477
BssNAI GTATAC 1 cut(s) 500
BssT1I CCWWGG 2 cut(s) 209, 420
Bst1107I GTATAC 1 cut(s) 500
BstDEI CTNAG 2 cut(s) 279, 427
BstDSI CCRYGG 1 cut(s) 420
BstENI CCTNNNNNAGG 1 cut(s) 430
BstF5I GGATG 1 cut(s) 441
BstFNI CGCG 1 cut(s) 29
BstKTI GATC 3 cut(s) 183, 362, 480
BstMAI GTCTC 3 cut(s) 29, 335, 500
BstMBI GATC 3 cut(s) 180, 359, 477
BstMWI GCNNNNNNNGC 3 cut(s) 416, 445, 454
BstSFI CTRYAG 1 cut(s) 390
BstUI CGCG 1 cut(s) 29
BstX2I RGATCY 1 cut(s) 477
BstYI RGATCY 1 cut(s) 477
BstZ17I GTATAC 1 cut(s) 500
BsuRI GGCC 7 cut(s) 121, 152, 315, 381, 419, 425, 448
BtgI CCRYGG 1 cut(s) 420
BtsCI GGATG 1 cut(s) 441
Cfr13I GGNCC 4 cut(s) 119, 151, 380, 576
CviAII CATG 8 cut(s) 143, 263, 377, 421, 440, 503, 510, 563
DdeI CTNAG 2 cut(s) 279, 427
DpnI GATC 3 cut(s) 182, 361, 479
DpnII GATC 3 cut(s) 180, 359, 477
DraI TTTAAA 1 cut(s) 238
Eco130I CCWWGG 2 cut(s) 209, 420
Eco147I AGGCCT 1 cut(s) 448
Eco32I GATATC 1 cut(s) 586
Eco47I GGWCC 1 cut(s) 576
EcoNI CCTNNNNNAGG 1 cut(s) 430
EcoRV GATATC 1 cut(s) 586
EcoT14I CCWWGG 2 cut(s) 209, 420
EcoT22I ATGCAT 2 cut(s) 276, 441
ErhI CCWWGG 2 cut(s) 209, 420
FaeI CATG 8 cut(s) 146, 266, 380, 424, 443, 506, 513, 566
FaqI GGGAC 1 cut(s) 304
FatI CATG 8 cut(s) 142, 262, 376, 420, 439, 502, 509, 562
FbaI TGATCA 1 cut(s) 180
FblI GTMKAC 1 cut(s) 499
FokI GGATG 1 cut(s) 448
FspBI CTAG 4 cut(s) 77, 210, 432, 495
GsuI CTGGAG 1 cut(s) 30
HaeIII GGCC 7 cut(s) 121, 152, 315, 381, 419, 425, 448
Hin1II CATG 8 cut(s) 146, 266, 380, 424, 443, 506, 513, 566
HinfI GANTC 1 cut(s) 258
Hpy166II GTNNAC 1 cut(s) 500
Hpy188I TCNGA 2 cut(s) 484, 580
Hpy188III TCNNGA 1 cut(s) 464
Hpy8I GTNNAC 1 cut(s) 500
HpyCH4V TGCA 3 cut(s) 266, 274, 439
HpyF10VI GCNNNNNNNGC 3 cut(s) 416, 445, 454
HpyF3I CTNAG 2 cut(s) 279, 427
Hsp92II CATG 8 cut(s) 146, 266, 380, 424, 443, 506, 513, 566
Ksp22I TGATCA 1 cut(s) 180
Kzo9I GATC 3 cut(s) 180, 359, 477
LmnI GCTCC 2 cut(s) 454, 602
LpnPI CCDG 5 cut(s) 102, 329, 392, 401, 462
LweI GCATC 2 cut(s) 419, 426
MaeI CTAG 4 cut(s) 77, 210, 432, 495
MaeIII GTNAC 2 cut(s) 37, 103
MalI GATC 3 cut(s) 182, 361, 479
MboI GATC 3 cut(s) 180, 359, 477
MflI RGATCY 1 cut(s) 477
MluCI AATT 5 cut(s) 68, 155, 304, 487, 551
MnlI CCTC 3 cut(s) 362, 436, 438
Mph1103I ATGCAT 2 cut(s) 276, 441
MseI TTAA 1 cut(s) 237
MvnI CGCG 1 cut(s) 29
MwoI GCNNNNNNNGC 3 cut(s) 416, 445, 454
NcoI CCATGG 1 cut(s) 420
NdeII GATC 3 cut(s) 180, 359, 477
NlaIII CATG 8 cut(s) 146, 266, 380, 424, 443, 506, 513, 566
NlaIV GGNNCC 4 cut(s) 175, 382, 456, 577
NmuCI GTSAC 2 cut(s) 37, 103
NsiI ATGCAT 2 cut(s) 276, 441
PceI AGGCCT 1 cut(s) 448
PfeI GAWTC 1 cut(s) 258
PspN4I GGNNCC 4 cut(s) 175, 382, 456, 577
PspPI GGNCC 4 cut(s) 119, 151, 380, 576
PsuI RGATCY 1 cut(s) 477
SaqAI TTAA 1 cut(s) 237
Sau3AI GATC 3 cut(s) 180, 359, 477
Sau96I GGNCC 4 cut(s) 119, 151, 380, 576
SetI ASST 5 cut(s) 179, 199, 236, 373, 433
SfaNI GCATC 2 cut(s) 419, 426
SfcI CTRYAG 1 cut(s) 390
SinI GGWCC 1 cut(s) 576
SmlI CTYRAG 1 cut(s) 464
SmoI CTYRAG 1 cut(s) 464
SpeI ACTAGT 1 cut(s) 494
Sse9I AATT 5 cut(s) 68, 155, 304, 487, 551
SseBI AGGCCT 1 cut(s) 448
SspMI CTAG 4 cut(s) 77, 210, 432, 495
StuI AGGCCT 1 cut(s) 448
StyI CCWWGG 2 cut(s) 209, 420
TaqI TCGA 1 cut(s) 247
TasI AATT 5 cut(s) 68, 155, 304, 487, 551
TfiI GAWTC 1 cut(s) 258
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
TseFI GTSAC 2 cut(s) 37, 103
Tsp45I GTSAC 2 cut(s) 37, 103
TspDTI ATGAA 1 cut(s) 544
TspGWI ACGGA 4 cut(s) 47, 270, 300, 381
VpaK11BI GGWCC 1 cut(s) 576
XagI CCTNNNNNAGG 1 cut(s) 430
XmaJI CCTAGG 1 cut(s) 209
XmiI GTMKAC 1 cut(s) 499
XspI CTAG 4 cut(s) 77, 210, 432, 495
Zsp2I ATGCAT 2 cut(s) 276, 441
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.