Rmu_sc0007986.1_g000007

aspartic-type endopeptidase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007986.1
Physical Location & Seq
Forward (+)
40060 .. 40395
336 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007986.1_g000007.1.cds

Sequence Viewer

Length: 336 bp
atggctggaccattacaattgattcatggtcgaggaccagctcaatttatgttgccaaatggcacaagtattaatgtcaccgaagctctatatgctcctagggctggaaggaccctattgagatttaaagatagagccaatgcttttcatgtggaaacacattgtgagaatggacaagagttcctttgcatcccctctattgactacggacataaacgagtattagagaaacttatgtgtcgatctagtgggttgtatgcaaccactattcgaattattgaatccaaccatgtcatgagagatgacttatgggattctgacacatataggctttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

12.62

Weight (kDa)

7.79

Isoelectric Point (pI)

37.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 164
AfiI CCNNNNNNNGG 1 cut(s) 104
AgsI TTSAA 1 cut(s) 281
AluBI AGCT 2 cut(s) 41, 86
AluI AGCT 2 cut(s) 41, 86
AseI ATTAAT 1 cut(s) 72
AspA2I CCTAGG 1 cut(s) 98
AspS9I GGNCC 3 cut(s) 8, 35, 111
AsuHPI GGTGA 1 cut(s) 70
AsuII TTCGAA 1 cut(s) 271
AvaII GGWCC 3 cut(s) 8, 35, 111
AvrII CCTAGG 1 cut(s) 98
BfaI CTAG 2 cut(s) 99, 246
BlnI CCTAGG 1 cut(s) 98
Bme18I GGWCC 3 cut(s) 8, 35, 111
BmgT120I GGNCC 3 cut(s) 8, 35, 111
BmiI GGNNCC 1 cut(s) 113
BmsI GCATC 1 cut(s) 198
Bpu14I TTCGAA 1 cut(s) 271
BsaJI CCNNGG 1 cut(s) 98
Bsc4I CCNNNNNNNGG 1 cut(s) 104
BseDI CCNNGG 1 cut(s) 98
BseGI GGATG 1 cut(s) 189
BseLI CCNNNNNNNGG 1 cut(s) 104
BslI CCNNNNNNNGG 1 cut(s) 104
Bsp119I TTCGAA 1 cut(s) 271
Bsp143I GATC 1 cut(s) 242
BspHI TCATGA 1 cut(s) 294
BspLI GGNNCC 1 cut(s) 113
BspT104I TTCGAA 1 cut(s) 271
BssECI CCNNGG 1 cut(s) 98
BssMI GATC 1 cut(s) 242
BssT1I CCWWGG 1 cut(s) 98
BstBI TTCGAA 1 cut(s) 271
BstF5I GGATG 1 cut(s) 189
BstKTI GATC 1 cut(s) 245
BstMBI GATC 1 cut(s) 242
BstMWI GCNNNNNNNGC 2 cut(s) 92, 101
BtsCI GGATG 1 cut(s) 189
CciI TCATGA 1 cut(s) 294
Cfr13I GGNCC 3 cut(s) 8, 35, 111
CviAII CATG 4 cut(s) 26, 149, 290, 295
CviJI RGCY 6 cut(s) 5, 41, 86, 104, 137, 331
CviKI_1 RGCY 6 cut(s) 5, 41, 86, 104, 137, 331
DpnI GATC 1 cut(s) 244
DpnII GATC 1 cut(s) 242
DraI TTTAAA 1 cut(s) 127
DraIII CACNNNGTG 1 cut(s) 164
Eco130I CCWWGG 1 cut(s) 98
Eco47I GGWCC 3 cut(s) 8, 35, 111
EcoO109I RGGNCCY 1 cut(s) 111
EcoT14I CCWWGG 1 cut(s) 98
ErhI CCWWGG 1 cut(s) 98
FaeI CATG 4 cut(s) 29, 152, 293, 298
FalI AAGNNNNNCTT 2 cut(s) 168, 200
FatI CATG 4 cut(s) 25, 148, 289, 294
FokI GGATG 1 cut(s) 176
FspBI CTAG 2 cut(s) 99, 246
Hin1II CATG 4 cut(s) 29, 152, 293, 298
HinfI GANTC 3 cut(s) 22, 281, 314
HphI GGTGA 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 319
Hpy188III TCNNGA 1 cut(s) 295
HpyAV CCTTC 1 cut(s) 102
HpyCH4V TGCA 2 cut(s) 189, 260
HpyF10VI GCNNNNNNNGC 2 cut(s) 92, 101
Hsp92II CATG 4 cut(s) 29, 152, 293, 298
Kzo9I GATC 1 cut(s) 242
LmnI GCTCC 1 cut(s) 100
LpnPI CCDG 2 cut(s) 51, 90
LweI GCATC 1 cut(s) 198
MaeI CTAG 2 cut(s) 99, 246
MaeIII GTNAC 1 cut(s) 76
MalI GATC 1 cut(s) 244
MboI GATC 1 cut(s) 242
MfeI CAATTG 1 cut(s) 17
MluCI AATT 3 cut(s) 17, 44, 273
MmeI TCCRAC 1 cut(s) 309
MnlI CCTC 2 cut(s) 26, 205
MseI TTAA 2 cut(s) 72, 126
MunI CAATTG 1 cut(s) 17
MwoI GCNNNNNNNGC 2 cut(s) 92, 101
NdeII GATC 1 cut(s) 242
NlaIII CATG 4 cut(s) 29, 152, 293, 298
NlaIV GGNNCC 1 cut(s) 113
NmuCI GTSAC 1 cut(s) 76
NspV TTCGAA 1 cut(s) 271
PagI TCATGA 1 cut(s) 294
PfeI GAWTC 3 cut(s) 22, 281, 314
PpuMI RGGWCCY 1 cut(s) 111
PshBI ATTAAT 1 cut(s) 72
Psp5II RGGWCCY 1 cut(s) 111
PspN4I GGNNCC 1 cut(s) 113
PspPI GGNCC 3 cut(s) 8, 35, 111
PspPPI RGGWCCY 1 cut(s) 111
SaqAI TTAA 2 cut(s) 72, 126
Sau3AI GATC 1 cut(s) 242
Sau96I GGNCC 3 cut(s) 8, 35, 111
SetI ASST 2 cut(s) 43, 88
SfaNI GCATC 1 cut(s) 198
SfuI TTCGAA 1 cut(s) 271
SinI GGWCC 3 cut(s) 8, 35, 111
Sse9I AATT 3 cut(s) 17, 44, 273
SspMI CTAG 2 cut(s) 99, 246
StyI CCWWGG 1 cut(s) 98
TaqI TCGA 3 cut(s) 31, 241, 271
TasI AATT 3 cut(s) 17, 44, 273
TfiI GAWTC 3 cut(s) 22, 281, 314
Tru1I TTAA 2 cut(s) 72, 126
Tru9I TTAA 2 cut(s) 72, 126
TseFI GTSAC 1 cut(s) 76
Tsp45I GTSAC 1 cut(s) 76
TspDTI ATGAA 2 cut(s) 14, 137
TspGWI ACGGA 1 cut(s) 222
VpaK11BI GGWCC 3 cut(s) 8, 35, 111
VspI ATTAAT 1 cut(s) 72
XmaJI CCTAGG 1 cut(s) 98
XspI CTAG 2 cut(s) 99, 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.