Rmu_ssc0000141.1_g000015

aspartic-type endopeptidase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000141.1
Physical Location & Seq
Reverse (-)
70150 .. 70821
672 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000141.1_g000015.1.cds

Sequence Viewer

Length: 606 bp
ctgcctactgctgtcatactccaccagaagctaaaacctgaccccagatcaccggagcagaaaaatcgccaccagaatcagccgcctgatgtgtctacaccaatgaaccgccgcctgcatcctcaaccctgctcaaaagcccagaagcaggcccagtcaacgcaaccctctgacgtcagcgcccagtcagcattcagtcagtggcctacgtcagtgtcagagtaccacgtcaagacctccggtcaacgaccagtcaatgccggtcaacctttttccggcgacttccggcgaccaatttttcgatcaagatttccggcaatttttcaaggaatggatgaacttcaatatcttgaggatagtgctactacgcataccattctactacataggcaattattcttggagatgttgcctacagattcatttgtgactacgatggctgggccatcaggtttagttcaaggacatggaatggtccaattcctattgccaaatggcaccttgattaaagtcattgaagctctctatgcttctaaggcaaatagaaccttattaagctttaaagatataagagccaacggattccatgcggaaacgcatagttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

201

Amino Acids

22.47

Weight (kDa)

9.72

Isoelectric Point (pI)

51.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 177
AccB1I GGYRCC 1 cut(s) 497
AccI GTMKAC 1 cut(s) 95
AciI CCGC 4 cut(s) 83, 109, 112, 590
AcyI GRCGYC 1 cut(s) 174
AfaI GTAC 1 cut(s) 224
AfiI CCNNNNNNNGG 2 cut(s) 148, 275
AgsI TTSAA 4 cut(s) 326, 344, 461, 518
AhdI GACNNNNNGTC 1 cut(s) 240
AjiI CACGTC 1 cut(s) 229
AluBI AGCT 3 cut(s) 31, 521, 558
AluI AGCT 3 cut(s) 31, 521, 558
AoxI GGCC 3 cut(s) 150, 203, 443
ArsI GACNNNNNNTTYG 2 cut(s) 282, 314
AspLEI GCGC 1 cut(s) 182
AspS9I GGNCC 3 cut(s) 151, 443, 475
AsuHPI GGTGA 1 cut(s) 42
AvaII GGWCC 1 cut(s) 475
BanI GGYRCC 1 cut(s) 497
BccI CCATC 2 cut(s) 430, 454
BcgI CGANNNNNNTGC 2 cut(s) 47, 81
BfmI CTRYAG 1 cut(s) 414
BfoI RGCGCY 1 cut(s) 183
BisI GCNGC 2 cut(s) 83, 112
BlsI GCNGC 2 cut(s) 84, 113
Bme18I GGWCC 1 cut(s) 475
BmeRI GACNNNNNGTC 1 cut(s) 240
BmgBI CACGTC 1 cut(s) 229
BmgT120I GGNCC 3 cut(s) 151, 443, 475
BmiI GGNNCC 1 cut(s) 499
BmrI ACTGGG 2 cut(s) 148, 178
BmsI GCATC 1 cut(s) 127
BmuI ACTGGG 2 cut(s) 148, 178
BpuEI CTTGAG 1 cut(s) 371
BsaHI GRCGYC 1 cut(s) 174
BsaWI WCCGGW 2 cut(s) 52, 239
Bsc4I CCNNNNNNNGG 2 cut(s) 148, 275
Bse118I RCCGGY 1 cut(s) 260
Bse1I ACTGG 3 cut(s) 154, 184, 251
BseGI GGATG 2 cut(s) 118, 340
BseLI CCNNNNNNNGG 2 cut(s) 148, 275
BseNI ACTGG 3 cut(s) 154, 184, 251
BseYI CCCAGC 1 cut(s) 440
BshFI GGCC 3 cut(s) 152, 205, 445
BshNI GGYRCC 1 cut(s) 497
BsiSI CCGG 6 cut(s) 53, 240, 261, 276, 286, 314
BslI CCNNNNNNNGG 2 cut(s) 148, 275
BsmI GAATGC 1 cut(s) 191
BsnI GGCC 3 cut(s) 152, 205, 445
Bsp143I GATC 2 cut(s) 47, 302
BspACI CCGC 4 cut(s) 83, 109, 112, 590
BspANI GGCC 3 cut(s) 152, 205, 445
BspLI GGNNCC 1 cut(s) 499
BspT107I GGYRCC 1 cut(s) 497
BsrFI RCCGGY 1 cut(s) 260
BsrI ACTGG 3 cut(s) 154, 184, 251
BssAI RCCGGY 1 cut(s) 260
BssMI GATC 2 cut(s) 47, 302
BssNI GRCGYC 1 cut(s) 174
BstACI GRCGYC 1 cut(s) 174
BstC8I GCNNGC 2 cut(s) 116, 150
BstDEI CTNAG 1 cut(s) 534
BstF5I GGATG 2 cut(s) 118, 340
BstH2I RGCGCY 1 cut(s) 183
BstHHI GCGC 1 cut(s) 182
BstKTI GATC 2 cut(s) 50, 305
BstMBI GATC 2 cut(s) 47, 302
BstMWI GCNNNNNNNGC 3 cut(s) 188, 527, 536
BstSFI CTRYAG 1 cut(s) 414
BsuRI GGCC 3 cut(s) 152, 205, 445
BtrI CACGTC 1 cut(s) 229
BtsCI GGATG 2 cut(s) 118, 340
BtsIMutI CAGTG 2 cut(s) 206, 219
Cac8I GCNNGC 2 cut(s) 116, 150
CfoI GCGC 1 cut(s) 182
Cfr10I RCCGGY 1 cut(s) 260
Cfr13I GGNCC 3 cut(s) 151, 443, 475
Csp6I GTAC 1 cut(s) 223
CviAII CATG 2 cut(s) 467, 587
CviQI GTAC 1 cut(s) 223
DdeI CTNAG 1 cut(s) 534
DpnI GATC 2 cut(s) 49, 304
DpnII GATC 2 cut(s) 47, 302
DraI TTTAAA 1 cut(s) 562
DriI GACNNNNNGTC 1 cut(s) 240
Eam1105I GACNNNNNGTC 1 cut(s) 240
Eco47I GGWCC 1 cut(s) 475
FaeI CATG 2 cut(s) 470, 590
FaiI YATR 8 cut(s) 17, 372, 387, 468, 528, 569, 588, 600
FatI CATG 2 cut(s) 466, 586
FblI GTMKAC 1 cut(s) 95
Fnu4HI GCNGC 2 cut(s) 83, 112
FokI GGATG 2 cut(s) 105, 347
Fsp4HI GCNGC 2 cut(s) 83, 112
GlaI GCGC 1 cut(s) 181
GluI GCNGC 2 cut(s) 83, 112
GsaI CCCAGC 1 cut(s) 444
HaeII RGCGCY 1 cut(s) 183
HaeIII GGCC 3 cut(s) 152, 205, 445
HapII CCGG 6 cut(s) 53, 240, 261, 276, 286, 314
HhaI GCGC 1 cut(s) 182
Hin1I GRCGYC 1 cut(s) 174
Hin1II CATG 2 cut(s) 470, 590
Hin6I GCGC 1 cut(s) 180
HinP1I GCGC 1 cut(s) 180
HincII GTYRAC 3 cut(s) 159, 245, 266
HindII GTYRAC 3 cut(s) 159, 245, 266
HindIII AAGCTT 1 cut(s) 556
HinfI GANTC 3 cut(s) 76, 419, 582
HpaII CCGG 6 cut(s) 53, 240, 261, 276, 286, 314
HphI GGTGA 1 cut(s) 42
Hpy166II GTNNAC 4 cut(s) 96, 159, 245, 266
Hpy188I TCNGA 2 cut(s) 172, 220
Hpy188III TCNNGA 3 cut(s) 232, 306, 350
Hpy8I GTNNAC 4 cut(s) 96, 159, 245, 266
HpyCH4IV ACGT 3 cut(s) 174, 209, 228
HpyCH4V TGCA 1 cut(s) 118
HpyF10VI GCNNNNNNNGC 3 cut(s) 188, 527, 536
HpyF3I CTNAG 1 cut(s) 534
HpySE526I ACGT 3 cut(s) 174, 209, 228
Hsp92I GRCGYC 1 cut(s) 174
Hsp92II CATG 2 cut(s) 470, 590
HspAI GCGC 1 cut(s) 180
Kzo9I GATC 2 cut(s) 47, 302
LmnI GCTCC 1 cut(s) 55
LweI GCATC 1 cut(s) 127
MaeII ACGT 3 cut(s) 174, 209, 228
MaeIII GTNAC 1 cut(s) 427
MalI GATC 2 cut(s) 49, 304
MboI GATC 2 cut(s) 47, 302
MluCI AATT 4 cut(s) 294, 318, 392, 479
MnlI CCTC 4 cut(s) 132, 178, 247, 346
MseI TTAA 3 cut(s) 507, 554, 561
MspI CCGG 6 cut(s) 53, 240, 261, 276, 286, 314
Mva1269I GAATGC 1 cut(s) 191
MwoI GCNNNNNNNGC 3 cut(s) 188, 527, 536
NdeII GATC 2 cut(s) 47, 302
NlaIII CATG 2 cut(s) 470, 590
NlaIV GGNNCC 1 cut(s) 499
NmuCI GTSAC 1 cut(s) 427
PctI GAATGC 1 cut(s) 191
PfeI GAWTC 3 cut(s) 76, 419, 582
PkrI GCNGC 2 cut(s) 84, 113
PspFI CCCAGC 1 cut(s) 440
PspN4I GGNNCC 1 cut(s) 499
PspPI GGNCC 3 cut(s) 151, 443, 475
RsaI GTAC 1 cut(s) 224
RsaNI GTAC 1 cut(s) 223
SaqAI TTAA 3 cut(s) 507, 554, 561
SatI GCNGC 2 cut(s) 83, 112
Sau3AI GATC 2 cut(s) 47, 302
Sau96I GGNCC 3 cut(s) 151, 443, 475
SfaNI GCATC 1 cut(s) 127
SfcI CTRYAG 1 cut(s) 414
SinI GGWCC 1 cut(s) 475
SmlI CTYRAG 1 cut(s) 350
SmoI CTYRAG 1 cut(s) 350
Sse9I AATT 4 cut(s) 294, 318, 392, 479
SsiI CCGC 4 cut(s) 83, 109, 112, 590
TaiI ACGT 3 cut(s) 177, 212, 231
TaqI TCGA 1 cut(s) 301
TasI AATT 4 cut(s) 294, 318, 392, 479
TauI GCSGC 2 cut(s) 85, 114
TfiI GAWTC 3 cut(s) 76, 419, 582
Tru1I TTAA 3 cut(s) 507, 554, 561
Tru9I TTAA 3 cut(s) 507, 554, 561
TscAI CASTG 2 cut(s) 206, 219
TseFI GTSAC 1 cut(s) 427
Tsp45I GTSAC 1 cut(s) 427
TspDTI ATGAA 3 cut(s) 119, 351, 411
TspGWI ACGGA 1 cut(s) 594
TspRI CASTG 2 cut(s) 206, 219
VpaK11BI GGWCC 1 cut(s) 475
XmiI GTMKAC 1 cut(s) 95
ZraI GACGTC 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.