Rmu_sc0002906.1_g000006

aspartic-type endopeptidase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002906.1
Physical Location & Seq
Forward (+)
20677 .. 21003
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002906.1_g000006.1.cds

Sequence Viewer

Length: 327 bp
atggattctagagaactacaatgtcttgcggatactgtgactacgcacaccattctacgccataggcaattattcttagagatgttgcttacacattcctctatgactacgatggctgggccatcaggtttagttcaaggacatgggatgactcaatttctattaccaaatggcaccttgattaaagtcacagaagctttctacgctcctaaggcaaatcgaaccttattgagctttaaagatgttagagccaacggattccatgcggaaacgtatactgagaacggaaaagagttcctttgcattacctctaatgactgcggatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

11.99

Weight (kDa)

6.49

Isoelectric Point (pI)

24.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 173
AccI GTMKAC 1 cut(s) 275
AciI CCGC 3 cut(s) 29, 266, 321
AgsI TTSAA 1 cut(s) 137
AluBI AGCT 2 cut(s) 197, 234
AluI AGCT 2 cut(s) 197, 234
AoxI GGCC 1 cut(s) 119
AspS9I GGNCC 1 cut(s) 119
AxyI CCTNAGG 1 cut(s) 210
BanI GGYRCC 1 cut(s) 173
BccI CCATC 2 cut(s) 106, 130
BciVI GTATCC 1 cut(s) 25
BfaI CTAG 1 cut(s) 9
BfuI GTATCC 1 cut(s) 25
BmgT120I GGNCC 1 cut(s) 119
BmiI GGNNCC 1 cut(s) 175
Bse21I CCTNAGG 1 cut(s) 210
BseGI GGATG 1 cut(s) 153
BseMII CTCAG 1 cut(s) 270
BseYI CCCAGC 1 cut(s) 116
BshFI GGCC 1 cut(s) 121
BshNI GGYRCC 1 cut(s) 173
BsnI GGCC 1 cut(s) 121
BspACI CCGC 3 cut(s) 29, 266, 321
BspANI GGCC 1 cut(s) 121
BspCNI CTCAG 1 cut(s) 271
BspLI GGNNCC 1 cut(s) 175
BspT107I GGYRCC 1 cut(s) 173
BssNAI GTATAC 1 cut(s) 276
Bst1107I GTATAC 1 cut(s) 276
Bst4CI ACNGT 1 cut(s) 37
BstDEI CTNAG 3 cut(s) 76, 210, 279
BstF5I GGATG 1 cut(s) 153
BstMWI GCNNNNNNNGC 2 cut(s) 203, 212
BstZ17I GTATAC 1 cut(s) 276
Bsu36I CCTNAGG 1 cut(s) 210
BsuI GTATCC 1 cut(s) 25
BsuRI GGCC 1 cut(s) 121
BtsCI GGATG 1 cut(s) 153
Cfr13I GGNCC 1 cut(s) 119
CviAII CATG 2 cut(s) 143, 263
CviJI RGCY 5 cut(s) 116, 121, 197, 234, 251
CviKI_1 RGCY 5 cut(s) 116, 121, 197, 234, 251
DdeI CTNAG 3 cut(s) 76, 210, 279
DraI TTTAAA 1 cut(s) 238
Eco81I CCTNAGG 1 cut(s) 210
FaeI CATG 2 cut(s) 146, 266
FaiI YATR 5 cut(s) 63, 104, 144, 264, 276
FalI AAGNNNNNCTT 2 cut(s) 282, 314
FatI CATG 2 cut(s) 142, 262
FblI GTMKAC 1 cut(s) 275
FokI GGATG 1 cut(s) 160
FspBI CTAG 1 cut(s) 9
GsaI CCCAGC 1 cut(s) 120
HaeIII GGCC 1 cut(s) 121
Hin1II CATG 2 cut(s) 146, 266
HindIII AAGCTT 1 cut(s) 195
HinfI GANTC 3 cut(s) 5, 151, 258
Hpy166II GTNNAC 1 cut(s) 276
Hpy188III TCNNGA 1 cut(s) 9
Hpy8I GTNNAC 1 cut(s) 276
HpyCH4III ACNGT 1 cut(s) 37
HpyCH4IV ACGT 1 cut(s) 272
HpyCH4V TGCA 1 cut(s) 303
HpyF10VI GCNNNNNNNGC 2 cut(s) 203, 212
HpyF3I CTNAG 3 cut(s) 76, 210, 279
HpySE526I ACGT 1 cut(s) 272
Hsp92II CATG 2 cut(s) 146, 266
LmnI GCTCC 1 cut(s) 211
LpnPI CCDG 2 cut(s) 102, 111
MaeI CTAG 1 cut(s) 9
MaeII ACGT 1 cut(s) 272
MaeIII GTNAC 2 cut(s) 37, 187
MluCI AATT 2 cut(s) 68, 155
MlyI GAGTC 1 cut(s) 145
MnlI CCTC 2 cut(s) 109, 319
MseI TTAA 2 cut(s) 183, 237
MwoI GCNNNNNNNGC 2 cut(s) 203, 212
NlaIII CATG 2 cut(s) 146, 266
NlaIV GGNNCC 1 cut(s) 175
NmuCI GTSAC 2 cut(s) 37, 187
PfeI GAWTC 2 cut(s) 5, 258
PleI GAGTC 1 cut(s) 145
PpsI GAGTC 1 cut(s) 145
PspFI CCCAGC 1 cut(s) 116
PspN4I GGNNCC 1 cut(s) 175
PspPI GGNCC 1 cut(s) 119
SaqAI TTAA 2 cut(s) 183, 237
Sau96I GGNCC 1 cut(s) 119
SchI GAGTC 1 cut(s) 145
SetI ASST 7 cut(s) 130, 179, 199, 227, 236, 275, 311
SgeI CNNG 8 cut(s) 21, 38, 129, 138, 149, 155, 190, 275
Sse9I AATT 2 cut(s) 68, 155
SsiI CCGC 3 cut(s) 29, 266, 321
SspMI CTAG 1 cut(s) 9
TaaI ACNGT 1 cut(s) 37
TaiI ACGT 1 cut(s) 275
TaqI TCGA 1 cut(s) 220
TasI AATT 2 cut(s) 68, 155
TfiI GAWTC 2 cut(s) 5, 258
Tru1I TTAA 2 cut(s) 183, 237
Tru9I TTAA 2 cut(s) 183, 237
TseFI GTSAC 2 cut(s) 37, 187
Tsp45I GTSAC 2 cut(s) 37, 187
TspGWI ACGGA 2 cut(s) 270, 300
XbaI TCTAGA 1 cut(s) 8
XmiI GTMKAC 1 cut(s) 275
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.