Rmu_sc0003628.1_g000013

aspartic-type endopeptidase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003628.1
Physical Location & Seq
Reverse (-)
34721 .. 35164
444 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003628.1_g000013.1.cds

Sequence Viewer

Length: 444 bp
atggatgaacttcaatgtcttgcggatagtgcgactacgcacaccattctacgacataggcaattattcttagagatgttgcctacatattcctctgtgactacgatggctgtgccatcaagtttagttcaaggacatggaatggacaaattccttttgcccaatggcaccttgattaaagtcactgaagctctctacgctcctaaggcaaatcgaaccttattaaggtttaaagatataagagccaacggattccatgcggaaacgcatagtgaaaacggaatagaattcctttgcattacctctaatgattgcggacgaaagtgcatcttagagaagcttatgtatcaatctagtggactttatgtcactacaattcgaccaattgaatccaataatgtcataagagaagatctcttggattcagacacatattggctttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

147

Amino Acids

16.63

Weight (kDa)

5.92

Isoelectric Point (pI)

41.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 167
AciI CCGC 3 cut(s) 23, 260, 315
AcsI RAATTY 2 cut(s) 149, 287
AcuI CTGAAG 1 cut(s) 207
AfiI CCNNNNNNNGG 1 cut(s) 225
AgsI TTSAA 3 cut(s) 14, 131, 389
AhdI GACNNNNNGTC 1 cut(s) 365
AluBI AGCT 2 cut(s) 191, 340
AluI AGCT 2 cut(s) 191, 340
ApoI RAATTY 2 cut(s) 149, 287
AxyI CCTNAGG 1 cut(s) 204
BanI GGYRCC 1 cut(s) 167
BccI CCATC 2 cut(s) 100, 124
BcgI CGANNNNNNTGC 2 cut(s) 94, 128
BfaI CTAG 1 cut(s) 354
BglII AGATCT 1 cut(s) 412
BmeRI GACNNNNNGTC 1 cut(s) 365
BmiI GGNNCC 1 cut(s) 169
BmsI GCATC 1 cut(s) 336
BplI GAGNNNNNCTC 2 cut(s) 399, 431
Bsc4I CCNNNNNNNGG 1 cut(s) 225
Bse21I CCTNAGG 1 cut(s) 204
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 225
BshNI GGYRCC 1 cut(s) 167
BslI CCNNNNNNNGG 1 cut(s) 225
Bsp143I GATC 1 cut(s) 412
BspACI CCGC 3 cut(s) 23, 260, 315
BspLI GGNNCC 1 cut(s) 169
BspT107I GGYRCC 1 cut(s) 167
BssMI GATC 1 cut(s) 412
BstDEI CTNAG 3 cut(s) 70, 204, 331
BstENI CCTNNNNNAGG 1 cut(s) 223
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 1 cut(s) 415
BstMBI GATC 1 cut(s) 412
BstMWI GCNNNNNNNGC 3 cut(s) 29, 197, 206
BstX2I RGATCY 1 cut(s) 412
BstYI RGATCY 1 cut(s) 412
Bsu36I CCTNAGG 1 cut(s) 204
BtsCI GGATG 1 cut(s) 10
BtsIMutI CAGTG 1 cut(s) 183
CviAII CATG 2 cut(s) 137, 257
CviJI RGCY 5 cut(s) 110, 191, 245, 340, 439
CviKI_1 RGCY 5 cut(s) 110, 191, 245, 340, 439
DdeI CTNAG 3 cut(s) 70, 204, 331
DpnI GATC 1 cut(s) 414
DpnII GATC 1 cut(s) 412
DraI TTTAAA 1 cut(s) 232
DriI GACNNNNNGTC 1 cut(s) 365
Eam1105I GACNNNNNGTC 1 cut(s) 365
Eco57I CTGAAG 1 cut(s) 207
Eco81I CCTNAGG 1 cut(s) 204
EcoNI CCTNNNNNAGG 1 cut(s) 223
EcoRI GAATTC 1 cut(s) 287
FaeI CATG 2 cut(s) 140, 260
FalI AAGNNNNNCTT 2 cut(s) 314, 346
FatI CATG 2 cut(s) 136, 256
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 354
Hin1II CATG 2 cut(s) 140, 260
HindIII AAGCTT 1 cut(s) 338
HinfI GANTC 3 cut(s) 252, 389, 422
Hpy166II GTNNAC 1 cut(s) 359
Hpy188I TCNGA 1 cut(s) 427
Hpy8I GTNNAC 1 cut(s) 359
HpyCH4V TGCA 2 cut(s) 297, 327
HpyF10VI GCNNNNNNNGC 3 cut(s) 29, 197, 206
HpyF3I CTNAG 3 cut(s) 70, 204, 331
Hsp92II CATG 2 cut(s) 140, 260
Kzo9I GATC 1 cut(s) 412
LmnI GCTCC 1 cut(s) 205
LweI GCATC 1 cut(s) 336
MaeI CTAG 1 cut(s) 354
MaeIII GTNAC 3 cut(s) 97, 181, 367
MalI GATC 1 cut(s) 414
MboI GATC 1 cut(s) 412
MboII GAAGA 1 cut(s) 422
MfeI CAATTG 1 cut(s) 384
MflI RGATCY 1 cut(s) 412
MluCI AATT 5 cut(s) 62, 149, 287, 375, 384
MnlI CCTC 2 cut(s) 103, 313
MseI TTAA 3 cut(s) 177, 224, 231
MunI CAATTG 1 cut(s) 384
MwoI GCNNNNNNNGC 3 cut(s) 29, 197, 206
NdeII GATC 1 cut(s) 412
NlaIII CATG 2 cut(s) 140, 260
NlaIV GGNNCC 1 cut(s) 169
NmuCI GTSAC 3 cut(s) 97, 181, 367
PfeI GAWTC 3 cut(s) 252, 389, 422
PspN4I GGNNCC 1 cut(s) 169
PsuI RGATCY 1 cut(s) 412
SaqAI TTAA 3 cut(s) 177, 224, 231
Sau3AI GATC 1 cut(s) 412
SetI ASST 6 cut(s) 173, 193, 221, 230, 305, 342
SfaNI GCATC 1 cut(s) 336
SgeI CNNG 8 cut(s) 32, 132, 143, 149, 184, 269, 366, 430
Sse9I AATT 5 cut(s) 62, 149, 287, 375, 384
SsiI CCGC 3 cut(s) 23, 260, 315
SspMI CTAG 1 cut(s) 354
TaqI TCGA 2 cut(s) 214, 379
TasI AATT 5 cut(s) 62, 149, 287, 375, 384
TfiI GAWTC 3 cut(s) 252, 389, 422
Tru1I TTAA 3 cut(s) 177, 224, 231
Tru9I TTAA 3 cut(s) 177, 224, 231
TscAI CASTG 1 cut(s) 190
TseFI GTSAC 3 cut(s) 97, 181, 367
Tsp45I GTSAC 3 cut(s) 97, 181, 367
TspDTI ATGAA 1 cut(s) 21
TspGWI ACGGA 2 cut(s) 264, 294
TspRI CASTG 1 cut(s) 190
XagI CCTNNNNNAGG 1 cut(s) 223
XapI RAATTY 2 cut(s) 149, 287
XspI CTAG 1 cut(s) 354
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.