Rroxscaffold_4G00323050

aspartic-type endopeptidase activity

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
53661826 .. 53665764
3939 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00323050.1

Sequence Viewer

Length: 324 bp
ATGTTTCCTGAAGAGCTAGAATGCCTCGCGGATAGTGCTACTATGCACACTATACTTCGAGATAGGCAATTATTCCTTGAGATTATACCTACTCAATCTTCAGTGACTATGATGGCAGGGTCATCTAAATTGATTCATGGCCGAGGACCAGCTCAATTCTTGTTGCCAAATGGCACAATCATTAATGTCATCGAAGTTCTCTACGCTGCTAGGGCCAAAAGAACCTTTTTGATTAAAGATATTAGAGCCAATGGTTTTCATGTGGAAACACATTGTGAGAATGGACAAGAGTTCCTTTGCATTACCTCTAATGGCTACGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

11.98

Weight (kDa)

5.76

Isoelectric Point (pI)

46.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 29
AciI CCGC 1 cut(s) 29
AcoI YGGCCR 1 cut(s) 139
AcuI CTGAAG 2 cut(s) 30, 84
AdeI CACNNNGTG 1 cut(s) 275
AluBI AGCT 2 cut(s) 16, 152
AluI AGCT 2 cut(s) 16, 152
AoxI GGCC 2 cut(s) 139, 213
ApeKI GCWGC 1 cut(s) 206
AseI ATTAAT 1 cut(s) 183
AspS9I GGNCC 2 cut(s) 146, 213
AvaII GGWCC 1 cut(s) 146
BbvI GCAGC 1 cut(s) 193
BccI CCATC 1 cut(s) 106
BfaI CTAG 2 cut(s) 17, 210
BisI GCNGC 1 cut(s) 207
BlsI GCNGC 1 cut(s) 208
Bme18I GGWCC 1 cut(s) 146
BmgT120I GGNCC 2 cut(s) 146, 213
BpuEI CTTGAG 1 cut(s) 98
BsaJI CCNNGG 1 cut(s) 142
BseDI CCNNGG 1 cut(s) 142
BseXI GCAGC 1 cut(s) 193
Bsh1236I CGCG 1 cut(s) 29
BshFI GGCC 2 cut(s) 141, 215
BsmI GAATGC 1 cut(s) 26
BsnI GGCC 2 cut(s) 141, 215
BspACI CCGC 1 cut(s) 29
BspANI GGCC 2 cut(s) 141, 215
BspFNI CGCG 1 cut(s) 29
BspQI GCTCTTC 1 cut(s) 6
BssECI CCNNGG 1 cut(s) 142
Bst6I CTCTTC 1 cut(s) 6
BstFNI CGCG 1 cut(s) 29
BstMWI GCNNNNNNNGC 2 cut(s) 35, 212
BstUI CGCG 1 cut(s) 29
BstV1I GCAGC 1 cut(s) 193
BsuRI GGCC 2 cut(s) 141, 215
BtsIMutI CAGTG 1 cut(s) 108
Cfr13I GGNCC 2 cut(s) 146, 213
CviAII CATG 2 cut(s) 137, 260
CviJI RGCY 6 cut(s) 16, 141, 152, 215, 248, 315
CviKI_1 RGCY 6 cut(s) 16, 141, 152, 215, 248, 315
DraIII CACNNNGTG 1 cut(s) 275
EaeI YGGCCR 1 cut(s) 139
Eam1104I CTCTTC 1 cut(s) 6
EarI CTCTTC 1 cut(s) 6
Eco47I GGWCC 1 cut(s) 146
Eco57I CTGAAG 2 cut(s) 30, 84
FaeI CATG 2 cut(s) 140, 263
FaiI YATR 6 cut(s) 44, 53, 86, 110, 138, 261
FalI AAGNNNNNCTT 2 cut(s) 279, 311
FatI CATG 2 cut(s) 136, 259
Fnu4HI GCNGC 1 cut(s) 207
Fsp4HI GCNGC 1 cut(s) 207
FspBI CTAG 2 cut(s) 17, 210
GluI GCNGC 1 cut(s) 207
HaeIII GGCC 2 cut(s) 141, 215
Hin1II CATG 2 cut(s) 140, 263
HinfI GANTC 1 cut(s) 133
Hpy188III TCNNGA 2 cut(s) 8, 59
HpyCH4V TGCA 2 cut(s) 46, 300
HpyF10VI GCNNNNNNNGC 2 cut(s) 35, 212
Hsp92II CATG 2 cut(s) 140, 263
LguI GCTCTTC 1 cut(s) 6
LpnPI CCDG 3 cut(s) 21, 102, 162
Lsp1109I GCAGC 1 cut(s) 193
MaeI CTAG 2 cut(s) 17, 210
MaeIII GTNAC 1 cut(s) 103
MboII GAAGA 2 cut(s) 23, 90
MluCI AATT 3 cut(s) 68, 128, 155
MnlI CCTC 3 cut(s) 35, 137, 316
MseI TTAA 2 cut(s) 183, 234
Mva1269I GAATGC 1 cut(s) 26
MvnI CGCG 1 cut(s) 29
MwoI GCNNNNNNNGC 2 cut(s) 35, 212
NlaIII CATG 2 cut(s) 140, 263
NmeAIII GCCGAG 1 cut(s) 167
NmuCI GTSAC 1 cut(s) 103
PciSI GCTCTTC 1 cut(s) 6
PctI GAATGC 1 cut(s) 26
PfeI GAWTC 1 cut(s) 133
PkrI GCNGC 1 cut(s) 208
PshBI ATTAAT 1 cut(s) 183
PspPI GGNCC 2 cut(s) 146, 213
SapI GCTCTTC 1 cut(s) 6
SaqAI TTAA 2 cut(s) 183, 234
SatI GCNGC 1 cut(s) 207
Sau96I GGNCC 2 cut(s) 146, 213
SetI ASST 5 cut(s) 18, 91, 154, 227, 308
SinI GGWCC 1 cut(s) 146
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 3 cut(s) 68, 128, 155
SsiI CCGC 1 cut(s) 29
SspMI CTAG 2 cut(s) 17, 210
TaqI TCGA 2 cut(s) 58, 192
TasI AATT 3 cut(s) 68, 128, 155
TfiI GAWTC 1 cut(s) 133
Tru1I TTAA 2 cut(s) 183, 234
Tru9I TTAA 2 cut(s) 183, 234
TscAI CASTG 1 cut(s) 108
TseFI GTSAC 1 cut(s) 103
TseI GCWGC 1 cut(s) 206
Tsp45I GTSAC 1 cut(s) 103
TspDTI ATGAA 2 cut(s) 125, 248
TspRI CASTG 1 cut(s) 108
VpaK11BI GGWCC 1 cut(s) 146
VspI ATTAAT 1 cut(s) 183
XspI CTAG 2 cut(s) 17, 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.