Rmu_sc0000588.1_g000018

aspartic-type endopeptidase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000588.1
Physical Location & Seq
Reverse (-)
53162 .. 53494
333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000588.1_g000018.1.cds

Sequence Viewer

Length: 333 bp
atggctgggccatcaggtttagttcaaggacatggaatggcccaattcctactgccaaatggcaccttgattaaagtcactgaagctctctactcttctaaggcaaatcgaactttattgagctttaaagatataagagccaacggattccatgcggaaatgcataatgagaacataaaagagttcccttgcattacctctaatgattgcggacgaaagcgcatcttagataagcttatgtgtcactctagtggactttatgtcactataattcgacctattgaatccaataatgtcacaagagaagatttcttggattctgacacatattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.28

Weight (kDa)

6.89

Isoelectric Point (pI)

37.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 62
AciI CCGC 2 cut(s) 155, 210
AcuI CTGAAG 1 cut(s) 102
AgsI TTSAA 2 cut(s) 26, 284
AhdI GACNNNNNGTC 1 cut(s) 260
AleI CACNNNNGTG 1 cut(s) 249
AluBI AGCT 3 cut(s) 86, 123, 235
AluI AGCT 3 cut(s) 86, 123, 235
AoxI GGCC 2 cut(s) 8, 39
AspLEI GCGC 1 cut(s) 222
AspS9I GGNCC 2 cut(s) 8, 40
BanI GGYRCC 1 cut(s) 62
BccI CCATC 1 cut(s) 19
BfaI CTAG 1 cut(s) 249
BmeRI GACNNNNNGTC 1 cut(s) 260
BmgT120I GGNCC 2 cut(s) 8, 40
BmiI GGNNCC 1 cut(s) 64
BmsI GCATC 1 cut(s) 231
BseYI CCCAGC 1 cut(s) 5
BshFI GGCC 2 cut(s) 10, 41
BshNI GGYRCC 1 cut(s) 62
BsnI GGCC 2 cut(s) 10, 41
BspACI CCGC 2 cut(s) 155, 210
BspANI GGCC 2 cut(s) 10, 41
BspLI GGNNCC 1 cut(s) 64
BspT107I GGYRCC 1 cut(s) 62
Bst6I CTCTTC 1 cut(s) 100
BstDEI CTNAG 2 cut(s) 99, 226
BstHHI GCGC 1 cut(s) 222
BsuRI GGCC 2 cut(s) 10, 41
BtsIMutI CAGTG 1 cut(s) 78
CfoI GCGC 1 cut(s) 222
Cfr13I GGNCC 2 cut(s) 8, 40
CviAII CATG 2 cut(s) 32, 152
CviJI RGCY 7 cut(s) 5, 10, 41, 86, 123, 140, 235
CviKI_1 RGCY 7 cut(s) 5, 10, 41, 86, 123, 140, 235
DdeI CTNAG 2 cut(s) 99, 226
DraI TTTAAA 1 cut(s) 127
DriI GACNNNNNGTC 1 cut(s) 260
Eam1104I CTCTTC 1 cut(s) 100
Eam1105I GACNNNNNGTC 1 cut(s) 260
EarI CTCTTC 1 cut(s) 100
Eco57I CTGAAG 1 cut(s) 102
EcoT22I ATGCAT 1 cut(s) 165
FaeI CATG 2 cut(s) 35, 155
FaiI YATR 9 cut(s) 33, 134, 153, 165, 176, 239, 261, 269, 328
FalI AAGNNNNNCTT 2 cut(s) 209, 241
FatI CATG 2 cut(s) 31, 151
FspBI CTAG 1 cut(s) 249
GlaI GCGC 1 cut(s) 221
GsaI CCCAGC 1 cut(s) 9
HaeIII GGCC 2 cut(s) 10, 41
HhaI GCGC 1 cut(s) 222
Hin1II CATG 2 cut(s) 35, 155
Hin6I GCGC 1 cut(s) 220
HinP1I GCGC 1 cut(s) 220
HindIII AAGCTT 1 cut(s) 233
HinfI GANTC 3 cut(s) 147, 284, 317
Hpy166II GTNNAC 1 cut(s) 254
Hpy188I TCNGA 1 cut(s) 322
Hpy8I GTNNAC 1 cut(s) 254
HpyCH4V TGCA 2 cut(s) 163, 192
HpyF3I CTNAG 2 cut(s) 99, 226
Hsp92II CATG 2 cut(s) 35, 155
HspAI GCGC 1 cut(s) 220
LweI GCATC 1 cut(s) 231
MaeI CTAG 1 cut(s) 249
MaeIII GTNAC 4 cut(s) 76, 242, 262, 295
MboII GAAGA 2 cut(s) 87, 317
MluCI AATT 2 cut(s) 44, 270
MnlI CCTC 1 cut(s) 208
Mph1103I ATGCAT 1 cut(s) 165
MseI TTAA 2 cut(s) 72, 126
MslI CAYNNNNRTG 1 cut(s) 249
NlaIII CATG 2 cut(s) 35, 155
NlaIV GGNNCC 1 cut(s) 64
NmuCI GTSAC 4 cut(s) 76, 242, 262, 295
NsiI ATGCAT 1 cut(s) 165
OliI CACNNNNGTG 1 cut(s) 249
PfeI GAWTC 3 cut(s) 147, 284, 317
PspFI CCCAGC 1 cut(s) 5
PspN4I GGNNCC 1 cut(s) 64
PspPI GGNCC 2 cut(s) 8, 40
RseI CAYNNNNRTG 1 cut(s) 249
SaqAI TTAA 2 cut(s) 72, 126
Sau96I GGNCC 2 cut(s) 8, 40
SetI ASST 7 cut(s) 19, 68, 88, 125, 200, 237, 280
SfaNI GCATC 1 cut(s) 231
SmiMI CAYNNNNRTG 1 cut(s) 249
Sse9I AATT 2 cut(s) 44, 270
SsiI CCGC 2 cut(s) 155, 210
SspMI CTAG 1 cut(s) 249
TaqI TCGA 2 cut(s) 109, 274
TasI AATT 2 cut(s) 44, 270
TfiI GAWTC 3 cut(s) 147, 284, 317
Tru1I TTAA 2 cut(s) 72, 126
Tru9I TTAA 2 cut(s) 72, 126
TscAI CASTG 1 cut(s) 85
TseFI GTSAC 4 cut(s) 76, 242, 262, 295
Tsp45I GTSAC 4 cut(s) 76, 242, 262, 295
TspGWI ACGGA 1 cut(s) 159
TspRI CASTG 1 cut(s) 85
XspI CTAG 1 cut(s) 249
Zsp2I ATGCAT 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.