Rmu_sc0005187.1_g000007

aspartic-type endopeptidase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005187.1
OG0002041
Physical Location & Seq
Forward (+)
33504 .. 34462
959 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005187.1_g000007.1.cds

Sequence Viewer

Length: 387 bp
atggtggtgacgccaccaaggaaagaaaccgtccccagaacgcttctaaagcacctcgatcaagggaacctgaccataaagatgcttgtcttagatgtggactacctggacattgggcaagggcgtgtaaagcaattattattagagatgttgcctacacattcctctgtgactacgatggctgggtcattagatttagttcaaggacatggaatggcccaattcctattgccaaatggcacattgattaatgtcgcagaagatctctacgctcctaaggcaaatcgaaccttattgagctttaaagatataagagccaacagattccatgcggaaactcataccgagaacggaaaagagttcttttgcattacctctaatgattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2 rve

Protein Analysis

128

Amino Acids

14.29

Weight (kDa)

6.5

Isoelectric Point (pI)

17.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 332
AcyI GRCGYC 1 cut(s) 11
AgsI TTSAA 1 cut(s) 203
AjnI CCWGG 1 cut(s) 105
AluBI AGCT 1 cut(s) 300
AluI AGCT 1 cut(s) 300
AoxI GGCC 1 cut(s) 216
AseI ATTAAT 1 cut(s) 249
AspS9I GGNCC 1 cut(s) 217
AsuHPI GGTGA 1 cut(s) 19
AxyI CCTNAGG 1 cut(s) 276
BccI CCATC 1 cut(s) 172
BciT130I CCWGG 1 cut(s) 107
BglII AGATCT 1 cut(s) 262
Bme1390I CCNGG 1 cut(s) 107
BmgT120I GGNCC 1 cut(s) 217
BmiI GGNNCC 1 cut(s) 68
BmrFI CCNGG 1 cut(s) 107
BmsI GCATC 1 cut(s) 72
BsaHI GRCGYC 1 cut(s) 11
BsaJI CCNNGG 1 cut(s) 17
Bse21I CCTNAGG 1 cut(s) 276
BseBI CCWGG 1 cut(s) 107
BseDI CCNNGG 1 cut(s) 17
BseYI CCCAGC 1 cut(s) 182
BshFI GGCC 1 cut(s) 218
BslFI GGGAC 1 cut(s) 17
BsmFI GGGAC 1 cut(s) 17
BsnI GGCC 1 cut(s) 218
Bsp143I GATC 2 cut(s) 58, 262
BspACI CCGC 1 cut(s) 332
BspANI GGCC 1 cut(s) 218
BspLI GGNNCC 1 cut(s) 68
BssECI CCNNGG 1 cut(s) 17
BssMI GATC 2 cut(s) 58, 262
BssNI GRCGYC 1 cut(s) 11
BssT1I CCWWGG 1 cut(s) 17
Bst2UI CCWGG 1 cut(s) 107
Bst4CI ACNGT 1 cut(s) 31
BstACI GRCGYC 1 cut(s) 11
BstDEI CTNAG 2 cut(s) 91, 276
BstKTI GATC 2 cut(s) 61, 265
BstMBI GATC 2 cut(s) 58, 262
BstMWI GCNNNNNNNGC 3 cut(s) 49, 130, 278
BstNI CCWGG 1 cut(s) 107
BstSCI CCNGG 1 cut(s) 105
BstX2I RGATCY 1 cut(s) 262
BstYI RGATCY 1 cut(s) 262
Bsu36I CCTNAGG 1 cut(s) 276
BsuRI GGCC 1 cut(s) 218
Cfr13I GGNCC 1 cut(s) 217
CseI GACGC 1 cut(s) 19
CviAII CATG 2 cut(s) 209, 329
CviJI RGCY 4 cut(s) 182, 218, 300, 317
CviKI_1 RGCY 4 cut(s) 182, 218, 300, 317
DdeI CTNAG 2 cut(s) 91, 276
DpnI GATC 2 cut(s) 60, 264
DpnII GATC 2 cut(s) 58, 262
DraI TTTAAA 1 cut(s) 304
Eco130I CCWWGG 1 cut(s) 17
Eco81I CCTNAGG 1 cut(s) 276
EcoRII CCWGG 1 cut(s) 105
EcoT14I CCWWGG 1 cut(s) 17
ErhI CCWWGG 1 cut(s) 17
FaeI CATG 2 cut(s) 212, 332
FaiI YATR 5 cut(s) 77, 210, 311, 330, 342
FaqI GGGAC 1 cut(s) 17
FatI CATG 2 cut(s) 208, 328
GsaI CCCAGC 1 cut(s) 186
HaeIII GGCC 1 cut(s) 218
HgaI GACGC 1 cut(s) 19
Hin1I GRCGYC 1 cut(s) 11
Hin1II CATG 2 cut(s) 212, 332
HinfI GANTC 1 cut(s) 324
HphI GGTGA 1 cut(s) 19
Hpy166II GTNNAC 1 cut(s) 100
Hpy8I GTNNAC 1 cut(s) 100
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4V TGCA 1 cut(s) 369
HpyF10VI GCNNNNNNNGC 3 cut(s) 49, 130, 278
HpyF3I CTNAG 2 cut(s) 91, 276
Hsp92I GRCGYC 1 cut(s) 11
Hsp92II CATG 2 cut(s) 212, 332
Kzo9I GATC 2 cut(s) 58, 262
LmnI GCTCC 1 cut(s) 277
LpnPI CCDG 5 cut(s) 49, 83, 92, 119, 168
LweI GCATC 1 cut(s) 72
MaeIII GTNAC 2 cut(s) 7, 169
MalI GATC 2 cut(s) 60, 264
MboI GATC 2 cut(s) 58, 262
MboII GAAGA 1 cut(s) 272
MflI RGATCY 1 cut(s) 262
MluCI AATT 2 cut(s) 134, 221
MnlI CCTC 3 cut(s) 65, 175, 385
MseI TTAA 2 cut(s) 249, 303
MslI CAYNNNNRTG 1 cut(s) 80
MspR9I CCNGG 1 cut(s) 107
MvaI CCWGG 1 cut(s) 107
MwoI GCNNNNNNNGC 3 cut(s) 49, 130, 278
NdeII GATC 2 cut(s) 58, 262
NlaIII CATG 2 cut(s) 212, 332
NlaIV GGNNCC 1 cut(s) 68
NmuCI GTSAC 2 cut(s) 7, 169
PfeI GAWTC 1 cut(s) 324
PshBI ATTAAT 1 cut(s) 249
Psp6I CCWGG 1 cut(s) 105
PspFI CCCAGC 1 cut(s) 182
PspGI CCWGG 1 cut(s) 105
PspN4I GGNNCC 1 cut(s) 68
PspPI GGNCC 1 cut(s) 217
PsuI RGATCY 1 cut(s) 262
RseI CAYNNNNRTG 1 cut(s) 80
SaqAI TTAA 2 cut(s) 249, 303
Sau3AI GATC 2 cut(s) 58, 262
Sau96I GGNCC 1 cut(s) 217
ScrFI CCNGG 1 cut(s) 107
SetI ASST 6 cut(s) 57, 72, 108, 293, 302, 377
SfaNI GCATC 1 cut(s) 72
SmiMI CAYNNNNRTG 1 cut(s) 80
Sse9I AATT 2 cut(s) 134, 221
SsiI CCGC 1 cut(s) 332
StyD4I CCNGG 1 cut(s) 105
StyI CCWWGG 1 cut(s) 17
TaaI ACNGT 1 cut(s) 31
TaqI TCGA 2 cut(s) 57, 286
TasI AATT 2 cut(s) 134, 221
TfiI GAWTC 1 cut(s) 324
Tru1I TTAA 2 cut(s) 249, 303
Tru9I TTAA 2 cut(s) 249, 303
TseFI GTSAC 2 cut(s) 7, 169
Tsp45I GTSAC 2 cut(s) 7, 169
TspGWI ACGGA 1 cut(s) 366
VspI ATTAAT 1 cut(s) 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.