Rmu_sc0008198.1_g000008

aspartic-type endopeptidase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008198.1
Physical Location & Seq
Forward (+)
28854 .. 29174
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008198.1_g000008.1.cds

Sequence Viewer

Length: 321 bp
atggatgaactacaatgtcttgcggatagtgcgactatgcacaccattctacgacatagacaattattcttagagatgttgcctacatattcctatgtgactacgatggctgggacatcaggtttagttcaaggacatggaatggcccaattcctattgccaaatggcaccttgattaaagtcactgaagctctctatgctcttaaggaaaatcgaaccttattgagctttaaagatataagagccaacggattccatgcggaaacacataatgagaatggaaaagagttcctttgcattacctctaatgattgcggatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.81

Weight (kDa)

5.89

Isoelectric Point (pI)

25.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 167
AciI CCGC 3 cut(s) 23, 260, 315
AcuI CTGAAG 1 cut(s) 207
AflII CTTAAG 1 cut(s) 203
AgsI TTSAA 1 cut(s) 131
AluBI AGCT 2 cut(s) 191, 228
AluI AGCT 2 cut(s) 191, 228
AoxI GGCC 1 cut(s) 144
AspS9I GGNCC 1 cut(s) 145
BanI GGYRCC 1 cut(s) 167
BccI CCATC 1 cut(s) 100
BfrI CTTAAG 1 cut(s) 203
BmgT120I GGNCC 1 cut(s) 145
BmiI GGNNCC 1 cut(s) 169
BseGI GGATG 1 cut(s) 10
BseYI CCCAGC 1 cut(s) 110
BshFI GGCC 1 cut(s) 146
BshNI GGYRCC 1 cut(s) 167
BslFI GGGAC 1 cut(s) 127
BsmFI GGGAC 1 cut(s) 127
BsnI GGCC 1 cut(s) 146
BspACI CCGC 3 cut(s) 23, 260, 315
BspANI GGCC 1 cut(s) 146
BspLI GGNNCC 1 cut(s) 169
BspT107I GGYRCC 1 cut(s) 167
BspTI CTTAAG 1 cut(s) 203
BstAFI CTTAAG 1 cut(s) 203
BstDEI CTNAG 1 cut(s) 70
BstF5I GGATG 1 cut(s) 10
BstMWI GCNNNNNNNGC 2 cut(s) 29, 197
BsuRI GGCC 1 cut(s) 146
BtsCI GGATG 1 cut(s) 10
BtsIMutI CAGTG 1 cut(s) 183
Cfr13I GGNCC 1 cut(s) 145
CviAII CATG 2 cut(s) 137, 257
CviJI RGCY 5 cut(s) 110, 146, 191, 228, 245
CviKI_1 RGCY 5 cut(s) 110, 146, 191, 228, 245
DdeI CTNAG 1 cut(s) 70
DraI TTTAAA 1 cut(s) 232
Eco57I CTGAAG 1 cut(s) 207
FaeI CATG 2 cut(s) 140, 260
FaiI YATR 9 cut(s) 38, 57, 88, 96, 138, 198, 239, 258, 270
FalI AAGNNNNNCTT 2 cut(s) 276, 308
FaqI GGGAC 1 cut(s) 127
FatI CATG 2 cut(s) 136, 256
FokI GGATG 1 cut(s) 17
GsaI CCCAGC 1 cut(s) 114
HaeIII GGCC 1 cut(s) 146
Hin1II CATG 2 cut(s) 140, 260
HinfI GANTC 1 cut(s) 252
HpyCH4V TGCA 2 cut(s) 40, 297
HpyF10VI GCNNNNNNNGC 2 cut(s) 29, 197
HpyF3I CTNAG 1 cut(s) 70
Hsp92II CATG 2 cut(s) 140, 260
LpnPI CCDG 2 cut(s) 96, 105
MaeIII GTNAC 2 cut(s) 97, 181
MluCI AATT 2 cut(s) 62, 149
MnlI CCTC 1 cut(s) 313
MseI TTAA 3 cut(s) 177, 204, 231
MspCI CTTAAG 1 cut(s) 203
MwoI GCNNNNNNNGC 2 cut(s) 29, 197
NlaIII CATG 2 cut(s) 140, 260
NlaIV GGNNCC 1 cut(s) 169
NmuCI GTSAC 2 cut(s) 97, 181
PfeI GAWTC 1 cut(s) 252
PspFI CCCAGC 1 cut(s) 110
PspN4I GGNNCC 1 cut(s) 169
PspPI GGNCC 1 cut(s) 145
SaqAI TTAA 3 cut(s) 177, 204, 231
Sau96I GGNCC 1 cut(s) 145
SetI ASST 6 cut(s) 124, 173, 193, 221, 230, 305
SgeI CNNG 7 cut(s) 32, 123, 132, 143, 149, 184, 269
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
Sse9I AATT 2 cut(s) 62, 149
SsiI CCGC 3 cut(s) 23, 260, 315
TaqI TCGA 1 cut(s) 214
TasI AATT 2 cut(s) 62, 149
TfiI GAWTC 1 cut(s) 252
Tru1I TTAA 3 cut(s) 177, 204, 231
Tru9I TTAA 3 cut(s) 177, 204, 231
TscAI CASTG 1 cut(s) 190
TseFI GTSAC 2 cut(s) 97, 181
Tsp45I GTSAC 2 cut(s) 97, 181
TspDTI ATGAA 1 cut(s) 21
TspGWI ACGGA 1 cut(s) 264
TspRI CASTG 1 cut(s) 190
Vha464I CTTAAG 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.