pycom17g15210

aspartic-type endopeptidase activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
13073628 .. 13073843
216 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g15210.1

Sequence Viewer

Length: 216 bp
ATGCTATTAATAAAGGGGCATAGCAAAGCCCAACTCGTGTTGCCCAATGGTACTTTGTTTACCATCAACGAAGTCTTATATCCTCCTCATTTTGGTCGAACATTGTTGAATTTTAAAGACATTCAAGCTAACAAATTCCATTATGAAACCAAGGAAGAAAATGGAGAGCTCTTTCTAGCTGTTTTCATAGGACGACTTCTGTTCGCTTTTACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.17

Weight (kDa)

8.12

Isoelectric Point (pI)

15.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 109, 134
AfaI GTAC 1 cut(s) 52
AfiI CCNNNNNNNGG 1 cut(s) 92
AgsI TTSAA 2 cut(s) 109, 125
AluBI AGCT 3 cut(s) 128, 169, 179
AluI AGCT 3 cut(s) 128, 169, 179
Alw21I GWGCWC 1 cut(s) 171
ApoI RAATTY 2 cut(s) 109, 134
AseI ATTAAT 1 cut(s) 8
BanII GRGCYC 1 cut(s) 171
BauI CACGAG 1 cut(s) 35
Bbv12I GWGCWC 1 cut(s) 171
BccI CCATC 1 cut(s) 71
BfaI CTAG 2 cut(s) 176, 214
BsaJI CCNNGG 1 cut(s) 150
Bsc4I CCNNNNNNNGG 1 cut(s) 92
BseDI CCNNGG 1 cut(s) 150
BseLI CCNNNNNNNGG 1 cut(s) 92
BseRI GAGGAG 1 cut(s) 75
BsiHKAI GWGCWC 1 cut(s) 171
BslI CCNNNNNNNGG 1 cut(s) 92
Bsp1286I GDGCHC 1 cut(s) 171
BssECI CCNNGG 1 cut(s) 150
BssSI CACGAG 1 cut(s) 35
BssT1I CCWWGG 1 cut(s) 150
Bst2BI CACGAG 1 cut(s) 35
Csp6I GTAC 1 cut(s) 51
CviJI RGCY 4 cut(s) 29, 128, 169, 179
CviKI_1 RGCY 4 cut(s) 29, 128, 169, 179
CviQI GTAC 1 cut(s) 51
DraI TTTAAA 1 cut(s) 115
Ecl136II GAGCTC 1 cut(s) 169
Eco130I CCWWGG 1 cut(s) 150
Eco24I GRGCYC 1 cut(s) 171
Eco53kI GAGCTC 1 cut(s) 169
EcoICRI GAGCTC 1 cut(s) 169
EcoT14I CCWWGG 1 cut(s) 150
EcoT38I GRGCYC 1 cut(s) 171
ErhI CCWWGG 1 cut(s) 150
FaiI YATR 4 cut(s) 21, 79, 144, 188
FriOI GRGCYC 1 cut(s) 171
FspBI CTAG 2 cut(s) 176, 214
Hpy166II GTNNAC 1 cut(s) 60
Hpy8I GTNNAC 1 cut(s) 60
MaeI CTAG 2 cut(s) 176, 214
MboII GAAGA 1 cut(s) 167
MhlI GDGCHC 1 cut(s) 171
MluCI AATT 2 cut(s) 109, 134
MnlI CCTC 2 cut(s) 93, 96
MseI TTAA 2 cut(s) 8, 114
PshBI ATTAAT 1 cut(s) 8
Psp124BI GAGCTC 1 cut(s) 171
RsaI GTAC 1 cut(s) 52
RsaNI GTAC 1 cut(s) 51
SacI GAGCTC 1 cut(s) 171
SaqAI TTAA 2 cut(s) 8, 114
SduI GDGCHC 1 cut(s) 171
SetI ASST 4 cut(s) 130, 171, 181, 215
SgeI CNNG 5 cut(s) 47, 49, 137, 163, 188
Sse9I AATT 2 cut(s) 109, 134
SspMI CTAG 2 cut(s) 176, 214
SstI GAGCTC 1 cut(s) 171
StyI CCWWGG 1 cut(s) 150
TaqI TCGA 1 cut(s) 97
TasI AATT 2 cut(s) 109, 134
Tru1I TTAA 2 cut(s) 8, 114
Tru9I TTAA 2 cut(s) 8, 114
TspDTI ATGAA 2 cut(s) 159, 175
VspI ATTAAT 1 cut(s) 8
XapI RAATTY 2 cut(s) 109, 134
XspI CTAG 2 cut(s) 176, 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.