Rmu_sc0000087.1_g000020

aspartic-type endopeptidase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000087.1
Physical Location & Seq
Reverse (-)
109334 .. 109666
333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000087.1_g000020.1.cds

Sequence Viewer

Length: 333 bp
atgttgcctacatattcctctgtgactacaatggctgggccatcaggtttagttcaaggacatggaatggcccaattcctattgccaaatggcaccttgatgaaagtcactgaagttctctacgcttctaaggcaaatcgaaccatattgagctttaaagatataaaagccaacagattccatgcagaaatgcataatgacaatggaaaagagttcctttgcattacctctaatgattgcggacgaaagcgcatcttagagaagcttatgtgtcaatctagtggactttatgtcactacaattcgaccaattgaatccaataatgtgatatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.17

Weight (kDa)

9.15

Isoelectric Point (pI)

37.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 92
AciI CCGC 1 cut(s) 240
AcuI CTGAAG 1 cut(s) 132
AgsI TTSAA 2 cut(s) 56, 314
AhdI GACNNNNNGTC 1 cut(s) 290
AluBI AGCT 2 cut(s) 153, 265
AluI AGCT 2 cut(s) 153, 265
AoxI GGCC 2 cut(s) 38, 69
AspLEI GCGC 1 cut(s) 252
AspS9I GGNCC 2 cut(s) 38, 70
BanI GGYRCC 1 cut(s) 92
BccI CCATC 1 cut(s) 49
BfaI CTAG 1 cut(s) 279
BmeRI GACNNNNNGTC 1 cut(s) 290
BmgT120I GGNCC 2 cut(s) 38, 70
BmiI GGNNCC 1 cut(s) 94
BmsI GCATC 1 cut(s) 261
BseYI CCCAGC 1 cut(s) 35
BshFI GGCC 2 cut(s) 40, 71
BshNI GGYRCC 1 cut(s) 92
BsnI GGCC 2 cut(s) 40, 71
BspACI CCGC 1 cut(s) 240
BspANI GGCC 2 cut(s) 40, 71
BspLI GGNNCC 1 cut(s) 94
BspT107I GGYRCC 1 cut(s) 92
BstDEI CTNAG 2 cut(s) 129, 256
BstHHI GCGC 1 cut(s) 252
BstMWI GCNNNNNNNGC 1 cut(s) 131
BsuRI GGCC 2 cut(s) 40, 71
BtsIMutI CAGTG 1 cut(s) 108
CfoI GCGC 1 cut(s) 252
Cfr13I GGNCC 2 cut(s) 38, 70
CviAII CATG 2 cut(s) 62, 182
CviJI RGCY 6 cut(s) 35, 40, 71, 153, 170, 265
CviKI_1 RGCY 6 cut(s) 35, 40, 71, 153, 170, 265
DdeI CTNAG 2 cut(s) 129, 256
DraI TTTAAA 1 cut(s) 157
DriI GACNNNNNGTC 1 cut(s) 290
Eam1105I GACNNNNNGTC 1 cut(s) 290
Eco57I CTGAAG 1 cut(s) 132
EcoT22I ATGCAT 1 cut(s) 195
FaeI CATG 2 cut(s) 65, 185
FaiI YATR 9 cut(s) 13, 63, 146, 164, 183, 195, 269, 291, 331
FalI AAGNNNNNCTT 4 cut(s) 201, 233, 239, 271
FatI CATG 2 cut(s) 61, 181
FspBI CTAG 1 cut(s) 279
GlaI GCGC 1 cut(s) 251
GsaI CCCAGC 1 cut(s) 39
HaeIII GGCC 2 cut(s) 40, 71
HhaI GCGC 1 cut(s) 252
Hin1II CATG 2 cut(s) 65, 185
Hin6I GCGC 1 cut(s) 250
HinP1I GCGC 1 cut(s) 250
HindIII AAGCTT 1 cut(s) 263
HinfI GANTC 2 cut(s) 177, 314
Hpy166II GTNNAC 1 cut(s) 284
Hpy8I GTNNAC 1 cut(s) 284
HpyCH4V TGCA 3 cut(s) 185, 193, 222
HpyF10VI GCNNNNNNNGC 1 cut(s) 131
HpyF3I CTNAG 2 cut(s) 129, 256
Hsp92II CATG 2 cut(s) 65, 185
HspAI GCGC 1 cut(s) 250
LpnPI CCDG 2 cut(s) 21, 30
LweI GCATC 1 cut(s) 261
MaeI CTAG 1 cut(s) 279
MaeIII GTNAC 3 cut(s) 22, 106, 292
MfeI CAATTG 1 cut(s) 309
MluCI AATT 3 cut(s) 74, 300, 309
MnlI CCTC 2 cut(s) 28, 238
Mph1103I ATGCAT 1 cut(s) 195
MseI TTAA 1 cut(s) 156
MslI CAYNNNNRTG 1 cut(s) 98
MunI CAATTG 1 cut(s) 309
MwoI GCNNNNNNNGC 1 cut(s) 131
NlaIII CATG 2 cut(s) 65, 185
NlaIV GGNNCC 1 cut(s) 94
NmuCI GTSAC 3 cut(s) 22, 106, 292
NsiI ATGCAT 1 cut(s) 195
PfeI GAWTC 2 cut(s) 177, 314
PspFI CCCAGC 1 cut(s) 35
PspN4I GGNNCC 1 cut(s) 94
PspPI GGNCC 2 cut(s) 38, 70
RseI CAYNNNNRTG 1 cut(s) 98
SaqAI TTAA 1 cut(s) 156
Sau96I GGNCC 2 cut(s) 38, 70
SetI ASST 5 cut(s) 49, 98, 155, 230, 267
SfaNI GCATC 1 cut(s) 261
SgeI CNNG 7 cut(s) 48, 57, 68, 74, 109, 194, 291
SmiMI CAYNNNNRTG 1 cut(s) 98
Sse9I AATT 3 cut(s) 74, 300, 309
SsiI CCGC 1 cut(s) 240
SspMI CTAG 1 cut(s) 279
TaqI TCGA 2 cut(s) 139, 304
TasI AATT 3 cut(s) 74, 300, 309
TfiI GAWTC 2 cut(s) 177, 314
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TscAI CASTG 1 cut(s) 115
TseFI GTSAC 3 cut(s) 22, 106, 292
Tsp45I GTSAC 3 cut(s) 22, 106, 292
TspDTI ATGAA 1 cut(s) 116
TspRI CASTG 1 cut(s) 115
XspI CTAG 1 cut(s) 279
Zsp2I ATGCAT 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.