RchiOBHm_Chr1g0343001

aspartic-type endopeptidase activity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
34825498 .. 34825971
474 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 207 bp
ATGGCTGGACCATCACAATTGATTCATGGTCGAGAACAATCTCAATTTATGTTGCCAAATGGCACAAGTATTAATGTCACCAAAGCTCTATATGCTCTTAGGGCTGGAAGAACCCTATTGAGTTTTAAAGATATAAGAGCCAATGGTTTTCATGTGGAAACACATTGTGAGAATGGACAAGAGTTCCTTTGCATCACCTCTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.52

Weight (kDa)

7.87

Isoelectric Point (pI)

29.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 167
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
AseI ATTAAT 1 cut(s) 72
AspS9I GGNCC 1 cut(s) 8
AsuHPI GGTGA 2 cut(s) 70, 187
AvaII GGWCC 1 cut(s) 8
BccI CCATC 1 cut(s) 19
Bme18I GGWCC 1 cut(s) 8
BmgT120I GGNCC 1 cut(s) 8
BmsI GCATC 1 cut(s) 201
BstDEI CTNAG 1 cut(s) 98
BstMWI GCNNNNNNNGC 2 cut(s) 92, 101
Cfr13I GGNCC 1 cut(s) 8
CviAII CATG 2 cut(s) 26, 152
CviJI RGCY 4 cut(s) 5, 86, 104, 140
CviKI_1 RGCY 4 cut(s) 5, 86, 104, 140
DdeI CTNAG 1 cut(s) 98
DraI TTTAAA 1 cut(s) 127
DraIII CACNNNGTG 1 cut(s) 167
Eco47I GGWCC 1 cut(s) 8
FaeI CATG 2 cut(s) 29, 155
FaiI YATR 6 cut(s) 27, 50, 91, 93, 134, 153
FalI AAGNNNNNCTT 2 cut(s) 171, 203
FatI CATG 2 cut(s) 25, 151
Hin1II CATG 2 cut(s) 29, 155
HinfI GANTC 1 cut(s) 22
HphI GGTGA 2 cut(s) 70, 187
Hpy188III TCNNGA 1 cut(s) 32
HpyCH4V TGCA 1 cut(s) 192
HpyF10VI GCNNNNNNNGC 2 cut(s) 92, 101
HpyF3I CTNAG 1 cut(s) 98
Hsp92II CATG 2 cut(s) 29, 155
LpnPI CCDG 1 cut(s) 90
LweI GCATC 1 cut(s) 201
MaeIII GTNAC 1 cut(s) 76
MboII GAAGA 1 cut(s) 120
MfeI CAATTG 1 cut(s) 17
MluCI AATT 3 cut(s) 17, 44, 202
MseI TTAA 3 cut(s) 72, 126, 205
MunI CAATTG 1 cut(s) 17
MwoI GCNNNNNNNGC 2 cut(s) 92, 101
NlaIII CATG 2 cut(s) 29, 155
NmuCI GTSAC 1 cut(s) 76
PfeI GAWTC 1 cut(s) 22
PshBI ATTAAT 1 cut(s) 72
PspPI GGNCC 1 cut(s) 8
SaqAI TTAA 3 cut(s) 72, 126, 205
Sau96I GGNCC 1 cut(s) 8
SetI ASST 2 cut(s) 88, 200
SfaNI GCATC 1 cut(s) 201
SgeI CNNG 7 cut(s) 18, 38, 44, 78, 117, 164, 191
SinI GGWCC 1 cut(s) 8
Sse9I AATT 3 cut(s) 17, 44, 202
TaqI TCGA 1 cut(s) 31
TasI AATT 3 cut(s) 17, 44, 202
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 3 cut(s) 72, 126, 205
Tru9I TTAA 3 cut(s) 72, 126, 205
TseFI GTSAC 1 cut(s) 76
Tsp45I GTSAC 1 cut(s) 76
TspDTI ATGAA 2 cut(s) 14, 140
VpaK11BI GGWCC 1 cut(s) 8
VspI ATTAAT 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.