RchiOBHm_Chr1g0334721

methyltransferase DDB_G0268948

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
26833385 .. 26834863
1479 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56341

Sequence Viewer

Length: 828 bp
ATGGCACGTCCATTTGACAAGCAGGCAGAGATATACGTGGAAGCTCGGCCAACGTATCAGGCAGAGATATACGTGGAAGCTCGGCCAACGTATCCCAAGGAATGGTATTCAAAGCTCGCTGCTCTCACCCCACAACACTCTTTAGCTTGGGATGTTGGCACTGGCAGTGGCCAAGCTACCGTCGGTCTTTTAGAGCATTACGACCAAGTAGTTGGAAGTGATATAAGTGAAGCACAATTGAACCATGCCATCCAGCACCCTCGAGTTCGATACGTTCACACTCCAACATCAATCTCAGACGATGAAATGGTTGACTTAATAGGGGGCGGTCATGAAAACTCAGTTGATTTGATTACAGTGGCTACTGCCGTTCACTGGTTTGATCTGCCACGCTTCTACTCGCTTGTCAAACGTCTTCTGCGTAAACCAGGAGGCATAATTGCTGTTTGGTCCTACAGCAGCATGGACAACATGGTCATAAGCCCTGACTTTGATCTTGCAATGAAGCGTTTACACGAAAATTGTATTCCATTTTGGGACCCGAGGGCAAAGTACGCATTTGAGGGTTATAGGACACTTCCTTTTCCATTTGAGAGCGTTGGATTGGGTCGTGAAGGTGAACCTATCACACTTGAAATACCAAGGGAATTGTCATTTCAGGGGGTTGAGAGGATGTTGAGGTCTTACTCTGTAGTCACTACGGCTAAAGACCAGGGTGTGGATTTGTTGTCTGAAGATGTGATTAAAGAACTTCAAAGAGCTTGGGGTGGGCATGATCTGATTAGATCAGTTACAATCAAGGCATGTATGCTTGTGGGCAAATTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

275

Amino Acids

31.04

Weight (kDa)

5.61

Isoelectric Point (pI)

33.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_11 PF08241 51 - 148 3.5e-09 Methyltransferase domain
Methyltransf_25 PF13649 51 - 144 1.8e-08 Methyltransferase domain
Methyltransf_12 PF08242 51 - 146 1.3e-07 Methyltransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 826
AasI GACNNNNNNGTC 1 cut(s) 473
AccB7I CCANNNNNTGG 2 cut(s) 102, 718
AciI CCGC 1 cut(s) 327
AcoI YGGCCR 3 cut(s) 47, 83, 169
AcuI CTGAAG 1 cut(s) 753
AfaI GTAC 1 cut(s) 554
AfiI CCNNNNNNNGG 3 cut(s) 102, 375, 718
AgsI TTSAA 4 cut(s) 111, 241, 635, 755
AjiI CACGTC 1 cut(s) 8
AjnI CCWGG 2 cut(s) 427, 711
AluBI AGCT 6 cut(s) 44, 80, 115, 146, 176, 761
AluI AGCT 6 cut(s) 44, 80, 115, 146, 176, 761
Ama87I CYCGRG 2 cut(s) 261, 541
AoxI GGCC 3 cut(s) 47, 83, 169
ApeKI GCWGC 2 cut(s) 119, 459
AspS9I GGNCC 2 cut(s) 450, 538
AsuHPI GGTGA 2 cut(s) 118, 629
AvaI CYCGRG 2 cut(s) 261, 541
AvaII GGWCC 2 cut(s) 450, 538
BalI TGGCCA 1 cut(s) 171
BbsI GAAGAC 1 cut(s) 407
BbvI GCAGC 2 cut(s) 106, 471
BccI CCATC 1 cut(s) 257
BceAI ACGGC 2 cut(s) 353, 717
BciT130I CCWGG 2 cut(s) 429, 713
BciVI GTATCC 1 cut(s) 102
BfmI CTRYAG 2 cut(s) 454, 690
BfuI GTATCC 1 cut(s) 102
BisI GCNGC 2 cut(s) 120, 460
BlsI GCNGC 2 cut(s) 121, 461
Bme1390I CCNGG 2 cut(s) 429, 713
Bme18I GGWCC 2 cut(s) 450, 538
BmeT110I CYCGRG 2 cut(s) 261, 541
BmgBI CACGTC 1 cut(s) 8
BmgT120I GGNCC 2 cut(s) 450, 538
BmiI GGNNCC 2 cut(s) 539, 540
BmrFI CCNGG 2 cut(s) 429, 713
BpiI GAAGAC 1 cut(s) 407
BsaAI YACGTR 2 cut(s) 37, 73
BsaJI CCNNGG 4 cut(s) 96, 542, 641, 712
Bsc4I CCNNNNNNNGG 3 cut(s) 102, 375, 718
Bse1I ACTGG 2 cut(s) 166, 380
Bse3DI GCAATG 1 cut(s) 507
BseBI CCWGG 2 cut(s) 429, 713
BseDI CCNNGG 4 cut(s) 96, 542, 641, 712
BseGI GGATG 3 cut(s) 157, 249, 678
BseLI CCNNNNNNNGG 3 cut(s) 102, 375, 718
BseMI GCAATG 1 cut(s) 507
BseMII CTCAG 2 cut(s) 309, 354
BseNI ACTGG 2 cut(s) 166, 380
BseXI GCAGC 2 cut(s) 106, 471
BshFI GGCC 3 cut(s) 49, 85, 171
BsiHKCI CYCGRG 2 cut(s) 261, 541
BslFI GGGAC 1 cut(s) 551
BslI CCNNNNNNNGG 3 cut(s) 102, 375, 718
BsmFI GGGAC 1 cut(s) 551
BsnI GGCC 3 cut(s) 49, 85, 171
BsoBI CYCGRG 2 cut(s) 261, 541
Bsp143I GATC 4 cut(s) 382, 493, 775, 785
BspACI CCGC 1 cut(s) 327
BspANI GGCC 3 cut(s) 49, 85, 171
BspCNI CTCAG 2 cut(s) 308, 353
BspHI TCATGA 1 cut(s) 331
BspLI GGNNCC 2 cut(s) 539, 540
BsrDI GCAATG 1 cut(s) 507
BsrI ACTGG 2 cut(s) 166, 380
BssECI CCNNGG 4 cut(s) 96, 542, 641, 712
BssMI GATC 4 cut(s) 382, 493, 775, 785
BssT1I CCWWGG 2 cut(s) 96, 641
Bst2UI CCWGG 2 cut(s) 429, 713
Bst4CI ACNGT 2 cut(s) 181, 358
BstBAI YACGTR 2 cut(s) 37, 73
BstC8I GCNNGC 2 cut(s) 24, 117
BstDEI CTNAG 2 cut(s) 295, 340
BstF5I GGATG 3 cut(s) 157, 249, 678
BstKTI GATC 4 cut(s) 385, 496, 778, 788
BstMBI GATC 4 cut(s) 382, 493, 775, 785
BstMWI GCNNNNNNNGC 1 cut(s) 554
BstNI CCWGG 2 cut(s) 429, 713
BstNSI RCATGY 1 cut(s) 807
BstSCI CCNGG 2 cut(s) 427, 711
BstSFI CTRYAG 2 cut(s) 454, 690
BstV1I GCAGC 2 cut(s) 106, 471
BstV2I GAAGAC 1 cut(s) 407
BstXI CCANNNNNNTGG 1 cut(s) 212
BsuI GTATCC 1 cut(s) 102
BsuRI GGCC 3 cut(s) 49, 85, 171
BtrI CACGTC 1 cut(s) 8
BtsCI GGATG 3 cut(s) 157, 249, 678
BtsI GCAGTG 1 cut(s) 172
BtsIMutI CAGTG 4 cut(s) 159, 172, 363, 373
Cac8I GCNNGC 2 cut(s) 24, 117
CciI TCATGA 1 cut(s) 331
Cfr13I GGNCC 2 cut(s) 450, 538
Csp6I GTAC 1 cut(s) 553
CviAII CATG 6 cut(s) 245, 332, 463, 472, 773, 804
CviQI GTAC 1 cut(s) 553
DdeI CTNAG 2 cut(s) 295, 340
DpnI GATC 4 cut(s) 384, 495, 777, 787
DpnII GATC 4 cut(s) 382, 493, 775, 785
DrdI GACNNNNNNGTC 1 cut(s) 473
DseDI GACNNNNNNGTC 1 cut(s) 473
EaeI YGGCCR 3 cut(s) 47, 83, 169
Eco130I CCWWGG 2 cut(s) 96, 641
Eco47I GGWCC 2 cut(s) 450, 538
Eco57I CTGAAG 1 cut(s) 753
Eco88I CYCGRG 2 cut(s) 261, 541
EcoO109I RGGNCCY 1 cut(s) 538
EcoRII CCWGG 2 cut(s) 427, 711
EcoT14I CCWWGG 2 cut(s) 96, 641
ErhI CCWWGG 2 cut(s) 96, 641
FaeI CATG 6 cut(s) 248, 335, 466, 475, 776, 807
FaqI GGGAC 1 cut(s) 551
FatI CATG 6 cut(s) 244, 331, 462, 471, 772, 803
Fnu4HI GCNGC 2 cut(s) 120, 460
FokI GGATG 3 cut(s) 164, 236, 685
Fsp4HI GCNGC 2 cut(s) 120, 460
GluI GCNGC 2 cut(s) 120, 460
HaeIII GGCC 3 cut(s) 49, 85, 171
Hin1II CATG 6 cut(s) 248, 335, 466, 475, 776, 807
HincII GTYRAC 1 cut(s) 313
HindII GTYRAC 1 cut(s) 313
HphI GGTGA 2 cut(s) 118, 629
Hpy166II GTNNAC 6 cut(s) 277, 313, 373, 425, 512, 620
Hpy188I TCNGA 3 cut(s) 298, 733, 780
Hpy188III TCNNGA 2 cut(s) 332, 611
Hpy8I GTNNAC 6 cut(s) 277, 313, 373, 425, 512, 620
Hpy99I CGWCG 1 cut(s) 185
HpyAV CCTTC 1 cut(s) 608
HpyCH4III ACNGT 2 cut(s) 181, 358
HpyCH4IV ACGT 7 cut(s) 7, 36, 53, 72, 89, 273, 412
HpyCH4V TGCA 1 cut(s) 500
HpyF10VI GCNNNNNNNGC 1 cut(s) 554
HpyF3I CTNAG 2 cut(s) 295, 340
HpySE526I ACGT 7 cut(s) 7, 36, 53, 72, 89, 273, 412
Hsp92II CATG 6 cut(s) 248, 335, 466, 475, 776, 807
KflI GGGWCCC 1 cut(s) 538
Kzo9I GATC 4 cut(s) 382, 493, 775, 785
Lsp1109I GCAGC 2 cut(s) 106, 471
MaeII ACGT 7 cut(s) 7, 36, 53, 72, 89, 273, 412
MaeIII GTNAC 2 cut(s) 694, 790
MalI GATC 4 cut(s) 384, 495, 777, 787
MboI GATC 4 cut(s) 382, 493, 775, 785
MboII GAAGA 2 cut(s) 407, 746
MfeI CAATTG 1 cut(s) 236
MlsI TGGCCA 1 cut(s) 171
MluCI AATT 5 cut(s) 236, 438, 520, 647, 821
MluNI TGGCCA 1 cut(s) 171
MmeI TCCRAC 3 cut(s) 193, 308, 580
MnlI CCTC 6 cut(s) 270, 425, 537, 556, 663, 672
Mox20I TGGCCA 1 cut(s) 171
MscI TGGCCA 1 cut(s) 171
MseI TTAA 2 cut(s) 317, 744
Msp20I TGGCCA 1 cut(s) 171
MspR9I CCNGG 2 cut(s) 429, 713
MunI CAATTG 1 cut(s) 236
MvaI CCWGG 2 cut(s) 429, 713
MwoI GCNNNNNNNGC 1 cut(s) 554
NdeII GATC 4 cut(s) 382, 493, 775, 785
NlaIII CATG 6 cut(s) 248, 335, 466, 475, 776, 807
NlaIV GGNNCC 2 cut(s) 539, 540
NmeAIII GCCGAG 2 cut(s) 25, 61
NmuCI GTSAC 1 cut(s) 694
NspI RCATGY 1 cut(s) 807
PaeR7I CTCGAG 1 cut(s) 261
PagI TCATGA 1 cut(s) 331
PcsI WCGNNNNNNNCGW 1 cut(s) 418
PflMI CCANNNNNTGG 2 cut(s) 102, 718
PkrI GCNGC 2 cut(s) 121, 461
Ppu21I YACGTR 2 cut(s) 37, 73
PpuMI RGGWCCY 1 cut(s) 538
PsiI TTATAA 1 cut(s) 826
Psp5II RGGWCCY 1 cut(s) 538
Psp6I CCWGG 2 cut(s) 427, 711
PspGI CCWGG 2 cut(s) 427, 711
PspN4I GGNNCC 2 cut(s) 539, 540
PspPI GGNCC 2 cut(s) 450, 538
PspPPI RGGWCCY 1 cut(s) 538
PspXI VCTCGAGB 1 cut(s) 261
RsaI GTAC 1 cut(s) 554
RsaNI GTAC 1 cut(s) 553
SaqAI TTAA 2 cut(s) 317, 744
SatI GCNGC 2 cut(s) 120, 460
Sau3AI GATC 4 cut(s) 382, 493, 775, 785
Sau96I GGNCC 2 cut(s) 450, 538
ScrFI CCNGG 2 cut(s) 429, 713
SfcI CTRYAG 2 cut(s) 454, 690
Sfr274I CTCGAG 1 cut(s) 261
SinI GGWCC 2 cut(s) 450, 538
SlaI CTCGAG 1 cut(s) 261
SmlI CTYRAG 1 cut(s) 261
SmoI CTYRAG 1 cut(s) 261
Sse9I AATT 5 cut(s) 236, 438, 520, 647, 821
SsiI CCGC 1 cut(s) 327
StyD4I CCNGG 2 cut(s) 427, 711
StyI CCWWGG 2 cut(s) 96, 641
TaaI ACNGT 2 cut(s) 181, 358
TaiI ACGT 7 cut(s) 10, 39, 56, 75, 92, 276, 415
TaqI TCGA 2 cut(s) 262, 268
TaqII GACCGA 1 cut(s) 173
TasI AATT 5 cut(s) 236, 438, 520, 647, 821
Tru1I TTAA 2 cut(s) 317, 744
Tru9I TTAA 2 cut(s) 317, 744
TscAI CASTG 4 cut(s) 166, 172, 363, 380
TseFI GTSAC 1 cut(s) 694
TseI GCWGC 2 cut(s) 119, 459
Tsp45I GTSAC 1 cut(s) 694
TspDTI ATGAA 3 cut(s) 318, 348, 518
TspRI CASTG 4 cut(s) 166, 172, 363, 380
Van91I CCANNNNNTGG 2 cut(s) 102, 718
VpaK11BI GGWCC 2 cut(s) 450, 538
XceI RCATGY 1 cut(s) 807
XhoI CTCGAG 1 cut(s) 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.