Rmu_sc0004498.1_g000007

methyltransferase DDB_G0268948

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004498.1
Physical Location & Seq
Forward (+)
41124 .. 42372
1249 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004498.1_g000007.1.cds

Sequence Viewer

Length: 783 bp
atggctggtctatttgacaagcaggcagagatatacgtggaagctcggccaacatatcccaaggaatggtattcaaagctggctgctctcacccctcaacactctttagcttgggatgttggcactggtaatggccaagctgctcttggtctttcagagcattacgagcaagtagtagcaagtgatataagtgaagcacagctgaaacatgccatccagcaccctcgagttcgatacattcacactccaacatcaatctcagacgatgaaatggtcaacttgatagggggcggtcatgagaattcagtggatttgatcactgtggcagaggctgttcattggtttgatctcccaaagttctactcgcttgccaaacgccttctgcgtaaaccaggaggcataattgctgtttgggcctacaacagaatgctggtaaacccagattttgatcctgtatttgaccgtttccgcgaaaactctataccatttacgcacccaaactcaaaatacgtaagggcggcttacaagacgcttccttttccatttgagagcgttggattgggtcgtgaaggtgaacctatcacagttgaaataccgaaggaatgttcatttcaggtggttgagaggatgttgaggtcttactctgcagtcactagagctaaggaccagggagtggacttgttgcctgaagaagtgataaaagagtttcaaagagcttggggtgggcatgatctggttagatcttttaagtacgaggcttttatgctcgtgggaaagttgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

260

Amino Acids

29.45

Weight (kDa)

6.15

Isoelectric Point (pI)

28.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 66, 673
AccII CGCG 1 cut(s) 471
AciI CCGC 3 cut(s) 291, 469, 518
AclWI GGATC 1 cut(s) 443
AcoI YGGCCR 2 cut(s) 47, 133
AcsI RAATTY 1 cut(s) 301
AcuI CTGAAG 1 cut(s) 708
AfaI GTAC 1 cut(s) 752
AfiI CCNNNNNNNGG 2 cut(s) 66, 673
AgsI TTSAA 3 cut(s) 75, 590, 710
AjnI CCWGG 2 cut(s) 391, 666
AluBI AGCT 7 cut(s) 44, 79, 110, 140, 202, 659, 716
AluI AGCT 7 cut(s) 44, 79, 110, 140, 202, 659, 716
AlwI GGATC 1 cut(s) 443
AlwNI CAGNNNCTG 1 cut(s) 332
Ama87I CYCGRG 1 cut(s) 225
AoxI GGCC 3 cut(s) 47, 133, 414
ApeKI GCWGC 2 cut(s) 83, 140
ApoI RAATTY 1 cut(s) 301
AspS9I GGNCC 2 cut(s) 414, 664
AsuHPI GGTGA 2 cut(s) 82, 584
AvaI CYCGRG 1 cut(s) 225
AvaII GGWCC 1 cut(s) 664
BalI TGGCCA 1 cut(s) 135
BauI CACGAG 1 cut(s) 767
BbvI GCAGC 2 cut(s) 70, 127
BccI CCATC 1 cut(s) 221
BciT130I CCWGG 2 cut(s) 393, 668
BclI TGATCA 1 cut(s) 315
BfaI CTAG 1 cut(s) 654
BfmI CTRYAG 1 cut(s) 645
BglII AGATCT 1 cut(s) 740
BisI GCNGC 3 cut(s) 84, 141, 519
BlsI GCNGC 3 cut(s) 85, 142, 520
Bme1390I CCNGG 2 cut(s) 393, 668
Bme18I GGWCC 1 cut(s) 664
BmeT110I CYCGRG 1 cut(s) 225
BmgT120I GGNCC 2 cut(s) 414, 664
BmrFI CCNGG 2 cut(s) 393, 668
Bpu10I CCTNAGC 1 cut(s) 660
BsaAI YACGTR 2 cut(s) 37, 511
BsaBI GATNNNNATC 1 cut(s) 447
BsaJI CCNNGG 2 cut(s) 60, 667
Bsc4I CCNNNNNNNGG 2 cut(s) 66, 673
Bse1I ACTGG 1 cut(s) 130
Bse8I GATNNNNATC 1 cut(s) 447
BseBI CCWGG 2 cut(s) 393, 668
BseDI CCNNGG 2 cut(s) 60, 667
BseGI GGATG 3 cut(s) 121, 213, 633
BseJI GATNNNNATC 1 cut(s) 447
BseLI CCNNNNNNNGG 2 cut(s) 66, 673
BseMII CTCAG 1 cut(s) 273
BseNI ACTGG 1 cut(s) 130
BseXI GCAGC 2 cut(s) 70, 127
Bsh1236I CGCG 1 cut(s) 471
BshFI GGCC 3 cut(s) 49, 135, 416
BsiHKCI CYCGRG 1 cut(s) 225
BslI CCNNNNNNNGG 2 cut(s) 66, 673
BsmI GAATGC 1 cut(s) 432
BsnI GGCC 3 cut(s) 49, 135, 416
BsoBI CYCGRG 1 cut(s) 225
Bsp143I GATC 5 cut(s) 315, 346, 448, 730, 740
BspACI CCGC 3 cut(s) 291, 469, 518
BspANI GGCC 3 cut(s) 49, 135, 416
BspCNI CTCAG 1 cut(s) 272
BspFNI CGCG 1 cut(s) 471
BspHI TCATGA 1 cut(s) 295
BspMAI CTGCAG 1 cut(s) 649
BspPI GGATC 1 cut(s) 443
BsrI ACTGG 1 cut(s) 130
BssECI CCNNGG 2 cut(s) 60, 667
BssMI GATC 5 cut(s) 315, 346, 448, 730, 740
BssSI CACGAG 1 cut(s) 767
BssT1I CCWWGG 1 cut(s) 60
Bst2BI CACGAG 1 cut(s) 767
Bst2UI CCWGG 2 cut(s) 393, 668
Bst4CI ACNGT 3 cut(s) 322, 464, 586
BstBAI YACGTR 2 cut(s) 37, 511
BstC8I GCNNGC 3 cut(s) 24, 81, 369
BstDEI CTNAG 2 cut(s) 259, 660
BstF5I GGATG 3 cut(s) 121, 213, 633
BstFNI CGCG 1 cut(s) 471
BstKTI GATC 5 cut(s) 318, 349, 451, 733, 743
BstMBI GATC 5 cut(s) 315, 346, 448, 730, 740
BstMWI GCNNNNNNNGC 2 cut(s) 166, 413
BstNI CCWGG 2 cut(s) 393, 668
BstNSI RCATGY 1 cut(s) 212
BstSCI CCNGG 2 cut(s) 391, 666
BstSFI CTRYAG 1 cut(s) 645
BstSNI TACGTA 1 cut(s) 511
BstUI CGCG 1 cut(s) 471
BstV1I GCAGC 2 cut(s) 70, 127
BstX2I RGATCY 1 cut(s) 740
BstYI RGATCY 1 cut(s) 740
BsuRI GGCC 3 cut(s) 49, 135, 416
BtsCI GGATG 3 cut(s) 121, 213, 633
BtsIMutI CAGTG 3 cut(s) 123, 312, 318
Cac8I GCNNGC 3 cut(s) 24, 81, 369
CaiI CAGNNNCTG 1 cut(s) 332
CciI TCATGA 1 cut(s) 295
Cfr13I GGNCC 2 cut(s) 414, 664
CseI GACGC 1 cut(s) 538
Csp6I GTAC 1 cut(s) 751
CviAII CATG 3 cut(s) 209, 296, 728
CviQI GTAC 1 cut(s) 751
DdeI CTNAG 2 cut(s) 259, 660
DpnI GATC 5 cut(s) 317, 348, 450, 732, 742
DpnII GATC 5 cut(s) 315, 346, 448, 730, 740
EaeI YGGCCR 2 cut(s) 47, 133
Eco105I TACGTA 1 cut(s) 511
Eco130I CCWWGG 1 cut(s) 60
Eco47I GGWCC 1 cut(s) 664
Eco57I CTGAAG 1 cut(s) 708
Eco88I CYCGRG 1 cut(s) 225
EcoRI GAATTC 1 cut(s) 301
EcoRII CCWGG 2 cut(s) 391, 666
EcoT14I CCWWGG 1 cut(s) 60
ErhI CCWWGG 1 cut(s) 60
FaeI CATG 3 cut(s) 212, 299, 731
FaiI YATR 9 cut(s) 34, 55, 188, 210, 297, 401, 482, 729, 764
FalI AAGNNNNNCTT 4 cut(s) 129, 161, 505, 537
FatI CATG 3 cut(s) 208, 295, 727
FbaI TGATCA 1 cut(s) 315
Fnu4HI GCNGC 3 cut(s) 84, 141, 519
FokI GGATG 3 cut(s) 128, 200, 640
Fsp4HI GCNGC 3 cut(s) 84, 141, 519
FspBI CTAG 1 cut(s) 654
GluI GCNGC 3 cut(s) 84, 141, 519
HaeIII GGCC 3 cut(s) 49, 135, 416
HgaI GACGC 1 cut(s) 538
Hin1II CATG 3 cut(s) 212, 299, 731
HincII GTYRAC 1 cut(s) 277
HindII GTYRAC 1 cut(s) 277
HphI GGTGA 2 cut(s) 82, 584
Hpy166II GTNNAC 5 cut(s) 277, 389, 436, 575, 676
Hpy188I TCNGA 2 cut(s) 157, 262
Hpy188III TCNNGA 2 cut(s) 296, 566
Hpy8I GTNNAC 5 cut(s) 277, 389, 436, 575, 676
HpyAV CCTTC 3 cut(s) 389, 563, 592
HpyCH4III ACNGT 3 cut(s) 322, 464, 586
HpyCH4IV ACGT 2 cut(s) 36, 510
HpyCH4V TGCA 1 cut(s) 647
HpyF10VI GCNNNNNNNGC 2 cut(s) 166, 413
HpyF3I CTNAG 2 cut(s) 259, 660
HpySE526I ACGT 2 cut(s) 36, 510
Hsp92II CATG 3 cut(s) 212, 299, 731
Ksp22I TGATCA 1 cut(s) 315
Kzo9I GATC 5 cut(s) 315, 346, 448, 730, 740
Lsp1109I GCAGC 2 cut(s) 70, 127
MaeI CTAG 1 cut(s) 654
MaeII ACGT 2 cut(s) 36, 510
MaeIII GTNAC 1 cut(s) 649
MalI GATC 5 cut(s) 317, 348, 450, 732, 742
MboI GATC 5 cut(s) 315, 346, 448, 730, 740
MboII GAAGA 1 cut(s) 701
MflI RGATCY 1 cut(s) 740
MlsI TGGCCA 1 cut(s) 135
MluCI AATT 2 cut(s) 301, 402
MluNI TGGCCA 1 cut(s) 135
MmeI TCCRAC 2 cut(s) 272, 535
MnlI CCTC 7 cut(s) 105, 234, 322, 389, 618, 627, 748
Mox20I TGGCCA 1 cut(s) 135
MscI TGGCCA 1 cut(s) 135
MseI TTAA 1 cut(s) 747
Msp20I TGGCCA 1 cut(s) 135
MspA1I CMGCKG 1 cut(s) 202
MspR9I CCNGG 2 cut(s) 393, 668
Mva1269I GAATGC 1 cut(s) 432
MvaI CCWGG 2 cut(s) 393, 668
MvnI CGCG 1 cut(s) 471
MwoI GCNNNNNNNGC 2 cut(s) 166, 413
NdeII GATC 5 cut(s) 315, 346, 448, 730, 740
NlaIII CATG 3 cut(s) 212, 299, 731
NmeAIII GCCGAG 1 cut(s) 25
NmuCI GTSAC 1 cut(s) 649
NspI RCATGY 1 cut(s) 212
PaeR7I CTCGAG 1 cut(s) 225
PagI TCATGA 1 cut(s) 295
PcsI WCGNNNNNNNCGW 1 cut(s) 382
PctI GAATGC 1 cut(s) 432
PflMI CCANNNNNTGG 2 cut(s) 66, 673
PkrI GCNGC 3 cut(s) 85, 142, 520
Ppu21I YACGTR 2 cut(s) 37, 511
Psp6I CCWGG 2 cut(s) 391, 666
PspGI CCWGG 2 cut(s) 391, 666
PspPI GGNCC 2 cut(s) 414, 664
PspXI VCTCGAGB 1 cut(s) 225
PstI CTGCAG 1 cut(s) 649
PstNI CAGNNNCTG 1 cut(s) 332
PsuI RGATCY 1 cut(s) 740
PvuII CAGCTG 1 cut(s) 202
RsaI GTAC 1 cut(s) 752
RsaNI GTAC 1 cut(s) 751
SaqAI TTAA 1 cut(s) 747
SatI GCNGC 3 cut(s) 84, 141, 519
Sau3AI GATC 5 cut(s) 315, 346, 448, 730, 740
Sau96I GGNCC 2 cut(s) 414, 664
ScrFI CCNGG 2 cut(s) 393, 668
SfcI CTRYAG 1 cut(s) 645
Sfr274I CTCGAG 1 cut(s) 225
SinI GGWCC 1 cut(s) 664
SlaI CTCGAG 1 cut(s) 225
SmlI CTYRAG 1 cut(s) 225
SmoI CTYRAG 1 cut(s) 225
SnaBI TACGTA 1 cut(s) 511
Sse9I AATT 2 cut(s) 301, 402
SsiI CCGC 3 cut(s) 291, 469, 518
SspMI CTAG 1 cut(s) 654
StyD4I CCNGG 2 cut(s) 391, 666
StyI CCWWGG 1 cut(s) 60
TaaI ACNGT 3 cut(s) 322, 464, 586
TaiI ACGT 2 cut(s) 39, 513
TaqI TCGA 2 cut(s) 226, 232
TasI AATT 2 cut(s) 301, 402
TauI GCSGC 1 cut(s) 521
Tru1I TTAA 1 cut(s) 747
Tru9I TTAA 1 cut(s) 747
TscAI CASTG 3 cut(s) 130, 312, 325
TseFI GTSAC 1 cut(s) 649
TseI GCWGC 2 cut(s) 83, 140
Tsp45I GTSAC 1 cut(s) 649
TspDTI ATGAA 3 cut(s) 282, 326, 597
TspRI CASTG 3 cut(s) 130, 312, 325
Van91I CCANNNNNTGG 2 cut(s) 66, 673
VpaK11BI GGWCC 1 cut(s) 664
XapI RAATTY 1 cut(s) 301
XceI RCATGY 1 cut(s) 212
XcmI CCANNNNNNNNNTGG 1 cut(s) 143
XhoI CTCGAG 1 cut(s) 225
XspI CTAG 1 cut(s) 654
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.