Rmu_co8155022.1_g000001

methyltransferase DDB_G0268948

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8155022.1
OG0001059
Physical Location & Seq
Reverse (-)
308 .. 592
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8155022.1_g000001.1.cds

Sequence Viewer

Length: 285 bp
atgacacagtacgcatgggggggttatacgacacttccttttccatttgagagcgttggattgggtcgtgaaggtgaacctatcacacttgaaataccaaaggaattgtcatttcaggggtttgaaaggatgttgaggtctttctctgcagtcgctacagctaaagaccgcggtgtggatttgttgtctgaagatgtgattaaagagcttcacagagcctggggtgcgcatgatctggttagatcagttacatacaaggcatttatgcttgtgggcagattataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Methyltransf_11

Protein Analysis

94

Amino Acids

10.59

Weight (kDa)

6.08

Isoelectric Point (pI)

27.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 283
Acc16I TGCGCA 1 cut(s) 228
AccII CGCG 1 cut(s) 171
AciI CCGC 2 cut(s) 169, 171
AcuI CTGAAG 1 cut(s) 210
AfaI GTAC 1 cut(s) 11
AfiI CCNNNNNNNGG 1 cut(s) 175
AgsI TTSAA 2 cut(s) 92, 125
AjnI CCWGG 1 cut(s) 218
AluBI AGCT 2 cut(s) 161, 208
AluI AGCT 2 cut(s) 161, 208
AlwNI CAGNNNCTG 1 cut(s) 219
ArsI GACNNNNNNTTYG 2 cut(s) 92, 124
AspLEI GCGC 1 cut(s) 229
AsuHPI GGTGA 1 cut(s) 86
BciT130I CCWGG 1 cut(s) 220
BfmI CTRYAG 2 cut(s) 147, 156
Bme1390I CCNGG 1 cut(s) 220
BmrFI CCNGG 1 cut(s) 220
BsaJI CCNNGG 2 cut(s) 169, 219
Bsc4I CCNNNNNNNGG 1 cut(s) 175
BseBI CCWGG 1 cut(s) 220
BseDI CCNNGG 2 cut(s) 169, 219
BseGI GGATG 1 cut(s) 135
BseLI CCNNNNNNNGG 1 cut(s) 175
Bsh1236I CGCG 1 cut(s) 171
BslI CCNNNNNNNGG 1 cut(s) 175
Bsp143I GATC 2 cut(s) 232, 242
BspACI CCGC 2 cut(s) 169, 171
BspFNI CGCG 1 cut(s) 171
BspMAI CTGCAG 1 cut(s) 151
BssECI CCNNGG 2 cut(s) 169, 219
BssMI GATC 2 cut(s) 232, 242
Bst2UI CCWGG 1 cut(s) 220
Bst4CI ACNGT 1 cut(s) 9
BstDSI CCRYGG 1 cut(s) 169
BstF5I GGATG 1 cut(s) 135
BstFNI CGCG 1 cut(s) 171
BstHHI GCGC 1 cut(s) 229
BstKTI GATC 2 cut(s) 235, 245
BstMBI GATC 2 cut(s) 232, 242
BstMWI GCNNNNNNNGC 1 cut(s) 224
BstNI CCWGG 1 cut(s) 220
BstSCI CCNGG 1 cut(s) 218
BstSFI CTRYAG 2 cut(s) 147, 156
BstUI CGCG 1 cut(s) 171
BtgI CCRYGG 1 cut(s) 169
BtsCI GGATG 1 cut(s) 135
CaiI CAGNNNCTG 1 cut(s) 219
CfoI GCGC 1 cut(s) 229
Cfr42I CCGCGG 1 cut(s) 172
Csp6I GTAC 1 cut(s) 10
CviAII CATG 2 cut(s) 15, 230
CviJI RGCY 3 cut(s) 161, 208, 218
CviKI_1 RGCY 3 cut(s) 161, 208, 218
CviQI GTAC 1 cut(s) 10
DpnI GATC 2 cut(s) 234, 244
DpnII GATC 2 cut(s) 232, 242
Eco57I CTGAAG 1 cut(s) 210
EcoRII CCWGG 1 cut(s) 218
FaeI CATG 2 cut(s) 18, 233
FaiI YATR 6 cut(s) 16, 27, 231, 253, 266, 283
FatI CATG 2 cut(s) 14, 229
FokI GGATG 1 cut(s) 142
FspAI RTGCGCAY 1 cut(s) 228
FspI TGCGCA 1 cut(s) 228
GlaI GCGC 1 cut(s) 228
HhaI GCGC 1 cut(s) 229
Hin1II CATG 2 cut(s) 18, 233
Hin6I GCGC 1 cut(s) 227
HinP1I GCGC 1 cut(s) 227
HphI GGTGA 1 cut(s) 86
Hpy166II GTNNAC 1 cut(s) 77
Hpy188I TCNGA 1 cut(s) 190
Hpy188III TCNNGA 1 cut(s) 68
Hpy8I GTNNAC 1 cut(s) 77
HpyAV CCTTC 1 cut(s) 65
HpyCH4III ACNGT 1 cut(s) 9
HpyCH4V TGCA 1 cut(s) 149
HpyF10VI GCNNNNNNNGC 1 cut(s) 224
Hsp92II CATG 2 cut(s) 18, 233
HspAI GCGC 1 cut(s) 227
KspI CCGCGG 1 cut(s) 172
Kzo9I GATC 2 cut(s) 232, 242
LpnPI CCDG 4 cut(s) 101, 205, 221, 232
MaeIII GTNAC 1 cut(s) 247
MalI GATC 2 cut(s) 234, 244
MboI GATC 2 cut(s) 232, 242
MboII GAAGA 1 cut(s) 203
MluCI AATT 1 cut(s) 104
MmeI TCCRAC 1 cut(s) 37
MnlI CCTC 1 cut(s) 129
MseI TTAA 1 cut(s) 201
MspA1I CMGCKG 1 cut(s) 171
MspR9I CCNGG 1 cut(s) 220
MvaI CCWGG 1 cut(s) 220
MvnI CGCG 1 cut(s) 171
MwoI GCNNNNNNNGC 1 cut(s) 224
NdeII GATC 2 cut(s) 232, 242
NlaIII CATG 2 cut(s) 18, 233
NsbI TGCGCA 1 cut(s) 228
PsiI TTATAA 1 cut(s) 283
Psp6I CCWGG 1 cut(s) 218
PspGI CCWGG 1 cut(s) 218
PstI CTGCAG 1 cut(s) 151
PstNI CAGNNNCTG 1 cut(s) 219
RsaI GTAC 1 cut(s) 11
RsaNI GTAC 1 cut(s) 10
SacII CCGCGG 1 cut(s) 172
SaqAI TTAA 1 cut(s) 201
Sau3AI GATC 2 cut(s) 232, 242
ScrFI CCNGG 1 cut(s) 220
SetI ASST 5 cut(s) 76, 82, 140, 163, 210
SfcI CTRYAG 2 cut(s) 147, 156
Sfr303I CCGCGG 1 cut(s) 172
SgrBI CCGCGG 1 cut(s) 172
Sse9I AATT 1 cut(s) 104
SsiI CCGC 2 cut(s) 169, 171
StyD4I CCNGG 1 cut(s) 218
TaaI ACNGT 1 cut(s) 9
TasI AATT 1 cut(s) 104
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.