Rorug07G0290900

methyltransferase DDB_G0268948

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
OG0001059
Physical Location & Seq
Forward (+)
28376856 .. 28378486
1631 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0290900.1

Sequence Viewer

Length: 195 bp
ATGTCGTCCAAGCAAGGTGGAAAGGCAAAGCCTTTGAAGCAACCCAAGGCTGAGAAGAAGGAGTACGACGAGGATGATTTGGCCAAGCTTCAGAAGAAGAAGGATGAGGAAAAGGCACTGAAGGAGCTTAGAGCCAAGGCATCACAGAAAGGGTCTTTTGGAGGTGCTGGCCTCAAGAAGAGTGGAAAGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Methyltransf_11

Protein Analysis

64

Amino Acids

7.0

Weight (kDa)

9.91

Isoelectric Point (pI)

45.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TMA7 PF09072 3 - 64 5.4e-24 Translation machinery associated TMA7
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 81
AcuI CTGAAG 2 cut(s) 74, 140
AfaI GTAC 1 cut(s) 65
AgsI TTSAA 1 cut(s) 37
AluBI AGCT 2 cut(s) 88, 127
AluI AGCT 2 cut(s) 88, 127
AoxI GGCC 2 cut(s) 81, 169
BalI TGGCCA 1 cut(s) 83
BarI GAAGNNNNNNTAC 2 cut(s) 47, 79
BmsI GCATC 1 cut(s) 149
BpuEI CTTGAG 1 cut(s) 158
BsaJI CCNNGG 2 cut(s) 45, 135
BseDI CCNNGG 2 cut(s) 45, 135
BseGI GGATG 2 cut(s) 79, 109
BseMII CTCAG 1 cut(s) 42
BshFI GGCC 2 cut(s) 83, 171
BsnI GGCC 2 cut(s) 83, 171
BspANI GGCC 2 cut(s) 83, 171
BspCNI CTCAG 1 cut(s) 43
BssECI CCNNGG 2 cut(s) 45, 135
BssT1I CCWWGG 2 cut(s) 45, 135
Bst6I CTCTTC 1 cut(s) 173
BstC8I GCNNGC 1 cut(s) 169
BstDEI CTNAG 2 cut(s) 51, 128
BstF5I GGATG 2 cut(s) 79, 109
BstMWI GCNNNNNNNGC 1 cut(s) 37
BsuRI GGCC 2 cut(s) 83, 171
BtsCI GGATG 2 cut(s) 79, 109
BtsIMutI CAGTG 1 cut(s) 116
Cac8I GCNNGC 1 cut(s) 169
Csp6I GTAC 1 cut(s) 64
CspCI CAANNNNNGTGG 2 cut(s) 33, 163
CviJI RGCY 7 cut(s) 31, 50, 83, 88, 127, 134, 171
CviKI_1 RGCY 7 cut(s) 31, 50, 83, 88, 127, 134, 171
CviQI GTAC 1 cut(s) 64
DdeI CTNAG 2 cut(s) 51, 128
EaeI YGGCCR 1 cut(s) 81
Eam1104I CTCTTC 1 cut(s) 173
EarI CTCTTC 1 cut(s) 173
Eco130I CCWWGG 2 cut(s) 45, 135
Eco57I CTGAAG 2 cut(s) 74, 140
EcoT14I CCWWGG 2 cut(s) 45, 135
ErhI CCWWGG 2 cut(s) 45, 135
FokI GGATG 2 cut(s) 86, 116
HaeIII GGCC 2 cut(s) 83, 171
HindIII AAGCTT 1 cut(s) 86
Hpy188I TCNGA 1 cut(s) 93
Hpy188III TCNNGA 1 cut(s) 175
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 3 cut(s) 52, 94, 115
HpyF10VI GCNNNNNNNGC 1 cut(s) 37
HpyF3I CTNAG 2 cut(s) 51, 128
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 1 cut(s) 153
LweI GCATC 1 cut(s) 149
MboII GAAGA 4 cut(s) 67, 106, 109, 190
MlsI TGGCCA 1 cut(s) 83
MluNI TGGCCA 1 cut(s) 83
MnlI CCTC 4 cut(s) 64, 100, 155, 182
Mox20I TGGCCA 1 cut(s) 83
MscI TGGCCA 1 cut(s) 83
Msp20I TGGCCA 1 cut(s) 83
MwoI GCNNNNNNNGC 1 cut(s) 37
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
SetI ASST 4 cut(s) 19, 90, 129, 166
SfaNI GCATC 1 cut(s) 149
SgeI CNNG 8 cut(s) 22, 26, 58, 82, 97, 148, 180, 187
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
StyI CCWWGG 2 cut(s) 45, 135
TscAI CASTG 1 cut(s) 123
TspRI CASTG 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.