RLG00000029428

methyltransferase DDB_G0268948

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Reverse (-)
38695908 .. 38712469
16562 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000029428

Sequence Viewer

Length: 792 bp
ATGGCACGTCTATTTGACAAGCAGGCAGAGATATACGTGGAAGCTCGGCCAACGTATCCCAAGGAATGGTATTCAAAGCTGTCTGCTCTCACCCCACAACACTCTTTAGCTTGGGATGCTGGCACTGGCAGTGGCCAAGCTACCGTCGGTCTTTTAGAGCATTACGACCAAGTAGTTGGAAGTGATATAAGTGAAGCACAATTGAAGCATGCCATCCAGCACCCTCGAGTTCGATACGTTCACACTCCAGCATCAATCTCAGACGATGAAATGGTTGACTTAATAGGGGGCGGTCATGAAAATTCAGTTGATTTGATTACAGTGGCTACTGCCGTTCACTGGTTTGATCTGCCACGCTTCTACTCGCTTGTCAAACGTCTTCTGCGTAAACCAGGAGGCATAATTGCTGTTTGGACCTACAAAAGCATGGACTTCATGGTCGTAAGCCCTGACTTTGATCTTGCAATGAAGCGTTTACACGAAAATTGTCTTCCATTTTGGGACCCGAGAGCAAAGTACGCATTTGAGGGTTATAGGACACTTCCTTTTCCATTTGAGAGCGTTGGATTGGGTCGTGAAGGTGAACCTATCCCACTTGAAATACCAAGGGAATTGTCATTTCAGGGGGTTGAGAGGATGTTGAGGTCTTACTCTGCAGTCCCTACGGCTAAAGACCAGGGTGTGGATTTGTTGTCTGAAGATGTGATTAAAGAACTTCAAAGAGCTTGGGGTGGGCATGATCTGATTAGATCAGTTACAGTCAAGGCATGTATGCTTGTGGGCAAATTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

264

Amino Acids

29.63

Weight (kDa)

5.99

Isoelectric Point (pI)

33.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_11 PF08241 39 - 136 4.5e-09 Methyltransferase domain
Methyltransf_25 PF13649 39 - 132 3.1e-08 Methyltransferase domain
Methyltransf_12 PF08242 39 - 134 3.7e-07 Methyltransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 790
AasI GACNNNNNNGTC 1 cut(s) 437
AccB7I CCANNNNNTGG 2 cut(s) 66, 682
AciI CCGC 1 cut(s) 291
AcoI YGGCCR 2 cut(s) 47, 133
AcsI RAATTY 1 cut(s) 301
AcuI CTGAAG 1 cut(s) 717
AfaI GTAC 1 cut(s) 518
AfiI CCNNNNNNNGG 3 cut(s) 66, 339, 682
AgsI TTSAA 4 cut(s) 75, 205, 599, 719
AjiI CACGTC 1 cut(s) 8
AjnI CCWGG 2 cut(s) 391, 675
AluBI AGCT 5 cut(s) 44, 79, 110, 140, 725
AluI AGCT 5 cut(s) 44, 79, 110, 140, 725
Ama87I CYCGRG 2 cut(s) 225, 505
AoxI GGCC 2 cut(s) 47, 133
ApoI RAATTY 1 cut(s) 301
AspS9I GGNCC 2 cut(s) 414, 502
AsuHPI GGTGA 2 cut(s) 82, 593
AvaI CYCGRG 2 cut(s) 225, 505
AvaII GGWCC 2 cut(s) 414, 502
BalI TGGCCA 1 cut(s) 135
BbsI GAAGAC 2 cut(s) 371, 482
BccI CCATC 1 cut(s) 221
BceAI ACGGC 2 cut(s) 317, 681
BciT130I CCWGG 2 cut(s) 393, 677
BciVI GTATCC 1 cut(s) 66
BfmI CTRYAG 1 cut(s) 654
BfuI GTATCC 1 cut(s) 66
Bme1390I CCNGG 2 cut(s) 393, 677
Bme18I GGWCC 2 cut(s) 414, 502
BmeT110I CYCGRG 2 cut(s) 225, 505
BmgBI CACGTC 1 cut(s) 8
BmgT120I GGNCC 2 cut(s) 414, 502
BmiI GGNNCC 2 cut(s) 503, 504
BmrFI CCNGG 2 cut(s) 393, 677
BmsI GCATC 2 cut(s) 106, 260
BpiI GAAGAC 2 cut(s) 371, 482
BpmI CTGGAG 1 cut(s) 231
BsaAI YACGTR 1 cut(s) 37
BsaJI CCNNGG 3 cut(s) 60, 605, 676
Bsc4I CCNNNNNNNGG 3 cut(s) 66, 339, 682
Bse1I ACTGG 2 cut(s) 130, 344
Bse3DI GCAATG 1 cut(s) 471
BseBI CCWGG 2 cut(s) 393, 677
BseDI CCNNGG 3 cut(s) 60, 605, 676
BseGI GGATG 3 cut(s) 121, 213, 642
BseLI CCNNNNNNNGG 3 cut(s) 66, 339, 682
BseMI GCAATG 1 cut(s) 471
BseMII CTCAG 1 cut(s) 273
BseNI ACTGG 2 cut(s) 130, 344
BshFI GGCC 2 cut(s) 49, 135
BsiHKCI CYCGRG 2 cut(s) 225, 505
BslFI GGGAC 2 cut(s) 515, 644
BslI CCNNNNNNNGG 3 cut(s) 66, 339, 682
BsmFI GGGAC 2 cut(s) 515, 644
BsnI GGCC 2 cut(s) 49, 135
BsoBI CYCGRG 2 cut(s) 225, 505
Bsp143I GATC 4 cut(s) 346, 457, 739, 749
BspACI CCGC 1 cut(s) 291
BspANI GGCC 2 cut(s) 49, 135
BspCNI CTCAG 1 cut(s) 272
BspHI TCATGA 1 cut(s) 295
BspLI GGNNCC 2 cut(s) 503, 504
BspMAI CTGCAG 1 cut(s) 658
BsrDI GCAATG 1 cut(s) 471
BsrI ACTGG 2 cut(s) 130, 344
BssECI CCNNGG 3 cut(s) 60, 605, 676
BssMI GATC 4 cut(s) 346, 457, 739, 749
BssT1I CCWWGG 2 cut(s) 60, 605
Bst2UI CCWGG 2 cut(s) 393, 677
Bst4CI ACNGT 3 cut(s) 145, 322, 760
BstBAI YACGTR 1 cut(s) 37
BstC8I GCNNGC 3 cut(s) 24, 121, 210
BstDEI CTNAG 1 cut(s) 259
BstF5I GGATG 3 cut(s) 121, 213, 642
BstKTI GATC 4 cut(s) 349, 460, 742, 752
BstMBI GATC 4 cut(s) 346, 457, 739, 749
BstMWI GCNNNNNNNGC 2 cut(s) 116, 518
BstNI CCWGG 2 cut(s) 393, 677
BstNSI RCATGY 2 cut(s) 212, 771
BstSCI CCNGG 2 cut(s) 391, 675
BstSFI CTRYAG 1 cut(s) 654
BstV2I GAAGAC 2 cut(s) 371, 482
BstXI CCANNNNNNTGG 1 cut(s) 176
BsuI GTATCC 1 cut(s) 66
BsuRI GGCC 2 cut(s) 49, 135
BtrI CACGTC 1 cut(s) 8
BtsCI GGATG 3 cut(s) 121, 213, 642
BtsI GCAGTG 1 cut(s) 136
BtsIMutI CAGTG 4 cut(s) 123, 136, 327, 337
Cac8I GCNNGC 3 cut(s) 24, 121, 210
CciI TCATGA 1 cut(s) 295
Cfr13I GGNCC 2 cut(s) 414, 502
Csp6I GTAC 1 cut(s) 517
CviAII CATG 6 cut(s) 209, 296, 427, 436, 737, 768
CviQI GTAC 1 cut(s) 517
DdeI CTNAG 1 cut(s) 259
DpnI GATC 4 cut(s) 348, 459, 741, 751
DpnII GATC 4 cut(s) 346, 457, 739, 749
DrdI GACNNNNNNGTC 1 cut(s) 437
DseDI GACNNNNNNGTC 1 cut(s) 437
EaeI YGGCCR 2 cut(s) 47, 133
Eco130I CCWWGG 2 cut(s) 60, 605
Eco47I GGWCC 2 cut(s) 414, 502
Eco57I CTGAAG 1 cut(s) 717
Eco88I CYCGRG 2 cut(s) 225, 505
EcoO109I RGGNCCY 1 cut(s) 502
EcoRII CCWGG 2 cut(s) 391, 675
EcoT14I CCWWGG 2 cut(s) 60, 605
ErhI CCWWGG 2 cut(s) 60, 605
FaeI CATG 6 cut(s) 212, 299, 430, 439, 740, 771
FaqI GGGAC 2 cut(s) 515, 644
FatI CATG 6 cut(s) 208, 295, 426, 435, 736, 767
FokI GGATG 3 cut(s) 128, 200, 649
GsuI CTGGAG 1 cut(s) 231
HaeIII GGCC 2 cut(s) 49, 135
Hin1II CATG 6 cut(s) 212, 299, 430, 439, 740, 771
HincII GTYRAC 1 cut(s) 277
HindII GTYRAC 1 cut(s) 277
HphI GGTGA 2 cut(s) 82, 593
Hpy166II GTNNAC 6 cut(s) 241, 277, 337, 389, 476, 584
Hpy188I TCNGA 3 cut(s) 262, 697, 744
Hpy188III TCNNGA 2 cut(s) 296, 575
Hpy8I GTNNAC 6 cut(s) 241, 277, 337, 389, 476, 584
Hpy99I CGWCG 1 cut(s) 149
HpyAV CCTTC 1 cut(s) 572
HpyCH4III ACNGT 3 cut(s) 145, 322, 760
HpyCH4IV ACGT 5 cut(s) 7, 36, 53, 237, 376
HpyCH4V TGCA 2 cut(s) 464, 656
HpyF10VI GCNNNNNNNGC 2 cut(s) 116, 518
HpyF3I CTNAG 1 cut(s) 259
HpySE526I ACGT 5 cut(s) 7, 36, 53, 237, 376
Hsp92II CATG 6 cut(s) 212, 299, 430, 439, 740, 771
KflI GGGWCCC 1 cut(s) 502
Kzo9I GATC 4 cut(s) 346, 457, 739, 749
LweI GCATC 2 cut(s) 106, 260
MaeII ACGT 5 cut(s) 7, 36, 53, 237, 376
MaeIII GTNAC 1 cut(s) 754
MalI GATC 4 cut(s) 348, 459, 741, 751
MboI GATC 4 cut(s) 346, 457, 739, 749
MboII GAAGA 3 cut(s) 371, 482, 710
MfeI CAATTG 1 cut(s) 200
MlsI TGGCCA 1 cut(s) 135
MluCI AATT 6 cut(s) 200, 301, 402, 484, 611, 785
MluNI TGGCCA 1 cut(s) 135
MmeI TCCRAC 2 cut(s) 157, 544
MnlI CCTC 5 cut(s) 234, 389, 520, 627, 636
Mox20I TGGCCA 1 cut(s) 135
MscI TGGCCA 1 cut(s) 135
MseI TTAA 2 cut(s) 281, 708
Msp20I TGGCCA 1 cut(s) 135
MspR9I CCNGG 2 cut(s) 393, 677
MunI CAATTG 1 cut(s) 200
MvaI CCWGG 2 cut(s) 393, 677
MwoI GCNNNNNNNGC 2 cut(s) 116, 518
NdeII GATC 4 cut(s) 346, 457, 739, 749
NlaIII CATG 6 cut(s) 212, 299, 430, 439, 740, 771
NlaIV GGNNCC 2 cut(s) 503, 504
NmeAIII GCCGAG 1 cut(s) 25
NspI RCATGY 2 cut(s) 212, 771
PaeI GCATGC 1 cut(s) 212
PaeR7I CTCGAG 1 cut(s) 225
PagI TCATGA 1 cut(s) 295
PcsI WCGNNNNNNNCGW 1 cut(s) 382
PflMI CCANNNNNTGG 2 cut(s) 66, 682
Ppu21I YACGTR 1 cut(s) 37
PpuMI RGGWCCY 1 cut(s) 502
PsiI TTATAA 1 cut(s) 790
Psp5II RGGWCCY 1 cut(s) 502
Psp6I CCWGG 2 cut(s) 391, 675
PspGI CCWGG 2 cut(s) 391, 675
PspN4I GGNNCC 2 cut(s) 503, 504
PspPI GGNCC 2 cut(s) 414, 502
PspPPI RGGWCCY 1 cut(s) 502
PspXI VCTCGAGB 1 cut(s) 225
PstI CTGCAG 1 cut(s) 658
RsaI GTAC 1 cut(s) 518
RsaNI GTAC 1 cut(s) 517
SaqAI TTAA 2 cut(s) 281, 708
Sau3AI GATC 4 cut(s) 346, 457, 739, 749
Sau96I GGNCC 2 cut(s) 414, 502
ScrFI CCNGG 2 cut(s) 393, 677
SfaNI GCATC 2 cut(s) 106, 260
SfcI CTRYAG 1 cut(s) 654
Sfr274I CTCGAG 1 cut(s) 225
SinI GGWCC 2 cut(s) 414, 502
SlaI CTCGAG 1 cut(s) 225
SmlI CTYRAG 1 cut(s) 225
SmoI CTYRAG 1 cut(s) 225
SphI GCATGC 1 cut(s) 212
Sse9I AATT 6 cut(s) 200, 301, 402, 484, 611, 785
SsiI CCGC 1 cut(s) 291
StyD4I CCNGG 2 cut(s) 391, 675
StyI CCWWGG 2 cut(s) 60, 605
TaaI ACNGT 3 cut(s) 145, 322, 760
TaiI ACGT 5 cut(s) 10, 39, 56, 240, 379
TaqI TCGA 2 cut(s) 226, 232
TaqII GACCGA 1 cut(s) 137
TasI AATT 6 cut(s) 200, 301, 402, 484, 611, 785
Tru1I TTAA 2 cut(s) 281, 708
Tru9I TTAA 2 cut(s) 281, 708
TscAI CASTG 4 cut(s) 130, 136, 327, 344
TspDTI ATGAA 4 cut(s) 282, 312, 424, 482
TspRI CASTG 4 cut(s) 130, 136, 327, 344
Van91I CCANNNNNTGG 2 cut(s) 66, 682
VpaK11BI GGWCC 2 cut(s) 414, 502
XapI RAATTY 1 cut(s) 301
XceI RCATGY 2 cut(s) 212, 771
XhoI CTCGAG 1 cut(s) 225
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.