Rmu_sc0004498.1_g000005

methyltransferase DDB_G0268948

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004498.1
OG0001059
Physical Location & Seq
Forward (+)
32472 .. 32798
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004498.1_g000005.1.cds

Sequence Viewer

Length: 327 bp
atgaagcgttttcacgaaaattgtctaccatttcgggacccgagggcaaagtacgcatttgagggttataggacacttccttttccatttgagagcgttggattgggtcgtgaaggtgaacctatcacacttgaaataccaagggaattgtcatttcagggggttgagaggatgttgaggtcttactctgcagtcactacggctaaagaccagggtgtggatttgttgtctgaagatgtgattaaagagcttcaaagatcttggggtgggcatgatctgattagatcagttacaatcaaggcatttatgcttgtgggcaaattataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Methyltransf_11

Protein Analysis

108

Amino Acids

12.38

Weight (kDa)

7.89

Isoelectric Point (pI)

41.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 325
AccB7I CCANNNNNTGG 1 cut(s) 217
AccI GTMKAC 1 cut(s) 25
AcuI CTGAAG 1 cut(s) 252
AfaI GTAC 1 cut(s) 53
AfiI CCNNNNNNNGG 1 cut(s) 217
AgsI TTSAA 2 cut(s) 134, 254
AjnI CCWGG 1 cut(s) 210
AluBI AGCT 1 cut(s) 250
AluI AGCT 1 cut(s) 250
Ama87I CYCGRG 1 cut(s) 40
AspS9I GGNCC 1 cut(s) 37
AsuHPI GGTGA 1 cut(s) 128
AvaI CYCGRG 1 cut(s) 40
AvaII GGWCC 1 cut(s) 37
BceAI ACGGC 1 cut(s) 216
BciT130I CCWGG 1 cut(s) 212
BfmI CTRYAG 1 cut(s) 189
BglII AGATCT 1 cut(s) 257
Bme1390I CCNGG 1 cut(s) 212
Bme18I GGWCC 1 cut(s) 37
BmeT110I CYCGRG 1 cut(s) 40
BmgT120I GGNCC 1 cut(s) 37
BmiI GGNNCC 2 cut(s) 38, 39
BmrFI CCNGG 1 cut(s) 212
BsaJI CCNNGG 3 cut(s) 41, 140, 211
Bsc4I CCNNNNNNNGG 1 cut(s) 217
BseBI CCWGG 1 cut(s) 212
BseDI CCNNGG 3 cut(s) 41, 140, 211
BseGI GGATG 1 cut(s) 177
BseLI CCNNNNNNNGG 1 cut(s) 217
BsiHKCI CYCGRG 1 cut(s) 40
BslFI GGGAC 1 cut(s) 50
BslI CCNNNNNNNGG 1 cut(s) 217
BsmFI GGGAC 1 cut(s) 50
BsoBI CYCGRG 1 cut(s) 40
Bsp143I GATC 3 cut(s) 257, 274, 284
BspLI GGNNCC 2 cut(s) 38, 39
BspMAI CTGCAG 1 cut(s) 193
BssECI CCNNGG 3 cut(s) 41, 140, 211
BssMI GATC 3 cut(s) 257, 274, 284
BssT1I CCWWGG 1 cut(s) 140
Bst2UI CCWGG 1 cut(s) 212
BstF5I GGATG 1 cut(s) 177
BstKTI GATC 3 cut(s) 260, 277, 287
BstMBI GATC 3 cut(s) 257, 274, 284
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstNI CCWGG 1 cut(s) 212
BstSCI CCNGG 1 cut(s) 210
BstSFI CTRYAG 1 cut(s) 189
BstX2I RGATCY 1 cut(s) 257
BstYI RGATCY 1 cut(s) 257
BtsCI GGATG 1 cut(s) 177
Cfr13I GGNCC 1 cut(s) 37
Csp6I GTAC 1 cut(s) 52
CviAII CATG 1 cut(s) 272
CviJI RGCY 2 cut(s) 203, 250
CviKI_1 RGCY 2 cut(s) 203, 250
CviQI GTAC 1 cut(s) 52
DpnI GATC 3 cut(s) 259, 276, 286
DpnII GATC 3 cut(s) 257, 274, 284
Eco130I CCWWGG 1 cut(s) 140
Eco47I GGWCC 1 cut(s) 37
Eco57I CTGAAG 1 cut(s) 252
Eco88I CYCGRG 1 cut(s) 40
EcoO109I RGGNCCY 1 cut(s) 37
EcoRII CCWGG 1 cut(s) 210
EcoT14I CCWWGG 1 cut(s) 140
ErhI CCWWGG 1 cut(s) 140
FaeI CATG 1 cut(s) 275
FaiI YATR 4 cut(s) 69, 273, 308, 325
FaqI GGGAC 1 cut(s) 50
FatI CATG 1 cut(s) 271
FblI GTMKAC 1 cut(s) 25
FokI GGATG 1 cut(s) 184
Hin1II CATG 1 cut(s) 275
HphI GGTGA 1 cut(s) 128
Hpy166II GTNNAC 2 cut(s) 26, 119
Hpy188I TCNGA 2 cut(s) 232, 279
Hpy188III TCNNGA 3 cut(s) 14, 35, 110
Hpy8I GTNNAC 2 cut(s) 26, 119
HpyAV CCTTC 1 cut(s) 107
HpyCH4V TGCA 1 cut(s) 191
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
Hsp92II CATG 1 cut(s) 275
KflI GGGWCCC 1 cut(s) 37
Kzo9I GATC 3 cut(s) 257, 274, 284
LpnPI CCDG 3 cut(s) 143, 197, 224
MaeIII GTNAC 2 cut(s) 193, 289
MalI GATC 3 cut(s) 259, 276, 286
MboI GATC 3 cut(s) 257, 274, 284
MboII GAAGA 1 cut(s) 245
MflI RGATCY 1 cut(s) 257
MluCI AATT 3 cut(s) 19, 146, 320
MmeI TCCRAC 1 cut(s) 79
MnlI CCTC 4 cut(s) 36, 55, 162, 171
MseI TTAA 1 cut(s) 243
MspR9I CCNGG 1 cut(s) 212
MvaI CCWGG 1 cut(s) 212
MwoI GCNNNNNNNGC 1 cut(s) 53
NdeII GATC 3 cut(s) 257, 274, 284
NlaIII CATG 1 cut(s) 275
NlaIV GGNNCC 2 cut(s) 38, 39
NmuCI GTSAC 1 cut(s) 193
PflMI CCANNNNNTGG 1 cut(s) 217
PpuMI RGGWCCY 1 cut(s) 37
PsiI TTATAA 1 cut(s) 325
Psp5II RGGWCCY 1 cut(s) 37
Psp6I CCWGG 1 cut(s) 210
PspGI CCWGG 1 cut(s) 210
PspN4I GGNNCC 2 cut(s) 38, 39
PspPI GGNCC 1 cut(s) 37
PspPPI RGGWCCY 1 cut(s) 37
PstI CTGCAG 1 cut(s) 193
PsuI RGATCY 1 cut(s) 257
RsaI GTAC 1 cut(s) 53
RsaNI GTAC 1 cut(s) 52
SaqAI TTAA 1 cut(s) 243
Sau3AI GATC 3 cut(s) 257, 274, 284
Sau96I GGNCC 1 cut(s) 37
ScrFI CCNGG 1 cut(s) 212
SetI ASST 4 cut(s) 118, 124, 182, 252
SfcI CTRYAG 1 cut(s) 189
SinI GGWCC 1 cut(s) 37
Sse9I AATT 3 cut(s) 19, 146, 320
StyD4I CCNGG 1 cut(s) 210
StyI CCWWGG 1 cut(s) 140
TasI AATT 3 cut(s) 19, 146, 320
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TseFI GTSAC 1 cut(s) 193
Tsp45I GTSAC 1 cut(s) 193
TspDTI ATGAA 1 cut(s) 17
Van91I CCANNNNNTGG 1 cut(s) 217
VpaK11BI GGWCC 1 cut(s) 37
XmiI GTMKAC 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.