RchiOBHm_Chr1g0341791

Metal tolerance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0000942
Physical Location & Seq
Reverse (-)
33623913 .. 33624977
1065 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56847

Sequence Viewer

Length: 195 bp
ATGAAATTAAGAGACTATATATGGCGTGGTCATGATCCTACCTCTGTTGCAGTCATGACTGAGGATGGCGTTGCTGTAGCTGGTCTTGCTATTGTTGCAACATCATTGGTTGCTGTAAATGTCACAGGAAATGGAATTTACGATCCTATAGGTTCATTTGTAGTTGGCAAGGATCTTGGAATGGTGGCTATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cation_efflux

Protein Analysis

64

Amino Acids

6.63

Weight (kDa)

4.82

Isoelectric Point (pI)

7.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 29, 137, 180
AcsI RAATTY 1 cut(s) 135
AluBI AGCT 1 cut(s) 80
AluI AGCT 1 cut(s) 80
Alw26I GTCTC 1 cut(s) 6
AlwI GGATC 3 cut(s) 29, 137, 180
ApoI RAATTY 1 cut(s) 135
BccI CCATC 1 cut(s) 59
BcoDI GTCTC 1 cut(s) 6
BfmI CTRYAG 2 cut(s) 75, 147
BseGI GGATG 1 cut(s) 70
BseMII CTCAG 1 cut(s) 51
BsmAI GTCTC 1 cut(s) 6
Bsp143I GATC 3 cut(s) 34, 142, 172
BspCNI CTCAG 1 cut(s) 52
BspHI TCATGA 2 cut(s) 31, 54
BspPI GGATC 3 cut(s) 29, 137, 180
BssMI GATC 3 cut(s) 34, 142, 172
BstDEI CTNAG 1 cut(s) 60
BstF5I GGATG 1 cut(s) 70
BstKTI GATC 3 cut(s) 37, 145, 175
BstMAI GTCTC 1 cut(s) 6
BstMBI GATC 3 cut(s) 34, 142, 172
BstMWI GCNNNNNNNGC 2 cut(s) 86, 95
BstSFI CTRYAG 2 cut(s) 75, 147
BstX2I RGATCY 1 cut(s) 172
BstYI RGATCY 1 cut(s) 172
BtsCI GGATG 1 cut(s) 70
CciI TCATGA 2 cut(s) 31, 54
CviAII CATG 2 cut(s) 32, 55
CviJI RGCY 2 cut(s) 80, 188
CviKI_1 RGCY 2 cut(s) 80, 188
DdeI CTNAG 1 cut(s) 60
DpnI GATC 3 cut(s) 36, 144, 174
DpnII GATC 3 cut(s) 34, 142, 172
FaeI CATG 2 cut(s) 35, 58
FaiI YATR 6 cut(s) 18, 20, 22, 33, 56, 149
FatI CATG 2 cut(s) 31, 54
FokI GGATG 1 cut(s) 77
Hin1II CATG 2 cut(s) 35, 58
Hpy188I TCNGA 1 cut(s) 194
Hpy188III TCNNGA 2 cut(s) 32, 55
HpyCH4V TGCA 2 cut(s) 50, 98
HpyF10VI GCNNNNNNNGC 2 cut(s) 86, 95
HpyF3I CTNAG 1 cut(s) 60
Hsp92II CATG 2 cut(s) 35, 58
Kzo9I GATC 3 cut(s) 34, 142, 172
LpnPI CCDG 2 cut(s) 66, 111
MaeIII GTNAC 1 cut(s) 121
MalI GATC 3 cut(s) 36, 144, 174
MboI GATC 3 cut(s) 34, 142, 172
MflI RGATCY 1 cut(s) 172
MluCI AATT 2 cut(s) 5, 135
MnlI CCTC 2 cut(s) 52, 55
MseI TTAA 1 cut(s) 8
MwoI GCNNNNNNNGC 2 cut(s) 86, 95
NdeII GATC 3 cut(s) 34, 142, 172
NlaIII CATG 2 cut(s) 35, 58
NmuCI GTSAC 1 cut(s) 121
PagI TCATGA 2 cut(s) 31, 54
PsuI RGATCY 1 cut(s) 172
SaqAI TTAA 1 cut(s) 8
Sau3AI GATC 3 cut(s) 34, 142, 172
SetI ASST 3 cut(s) 44, 82, 154
SfcI CTRYAG 2 cut(s) 75, 147
SgeI CNNG 8 cut(s) 38, 44, 67, 93, 98, 138, 181, 188
Sse9I AATT 2 cut(s) 5, 135
TasI AATT 2 cut(s) 5, 135
Tru1I TTAA 1 cut(s) 8
Tru9I TTAA 1 cut(s) 8
TseFI GTSAC 1 cut(s) 121
Tsp45I GTSAC 1 cut(s) 121
TspDTI ATGAA 2 cut(s) 17, 144
XapI RAATTY 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.