Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2A

Orthogroup ID

OG0000942

Physical Location & Seq

Genomic Coordinates Reverse (-)

78143671 .. 78151975

Gene Structure 8305 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2AG551100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 528 bp

ATGCAAGTACATAAGTCACCATGGAACATACGAGACAAACCAAGGTTTGCATATCGAGGGCTTTTGCTTGGATGTCTTGGTTCAGGTGCAACTATAGTTCATGGAGTTCAAAACTTGTGGGTTTCACAACCCCCTCCAAATATTCAATATGCAGCTATAGTGATTGGTGGTTCGTTTATTATTGAAGGCGCTTCTCTTCTTGTTGCCATACAAGCTGTCAAGAAAGGTCCTGCTGCTGAGGGCATGAAATTAAGAGACTATATATGGCGTGGTCATGATCCTACCTCTGTTGCAGTCATGACTGAGGATGGCGCTGCTATAGCTGGTCTTGCTATTGCTGCAGCATCATTAGTTGCTGTAAATGTCACAGGAAATGGAATTTACGATCCTATAGGTTCAATTGTAGTTGGCAACCTTCTTGGAATGGTGGCTATCTGTCTGATACAATGGAATCGACATGCTTTAATTGGTAGGGCAATGGATGACTATGATGTAGAGAAGCCTTGTCCACTCCAAATTATCTATTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cation_efflux

Protein Analysis

175

Amino Acids

18.63

Weight (kDa)

7.74

Isoelectric Point (pI)

29.28

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Cation_efflux	PF01545	26 - 147	2.3e-07	Cation efflux transmembrane domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000942)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G51610
fragaria_vesca	FvH4_6g16400 FvH4_6g37160
malus_domestica	MD09G1160600.v1.1 MD17G1146400.v1.1
prunus_persica	Prupe.3G019200_v2.0.a1 Prupe.3G019200_v2.0.a1 Prupe.3G019200_v2.0.a1
pyrus_communis	pycom08g05510 pycom09g07920 pycom10g14680 pycom17g13910
rosa_chinensis	RchiOBHm_Chr1g0341791 RchiOBHm_Chr2g0132611 RchiOBHm_Chr2g0145001 RchiOBHm_Chr2g0149771 RchiOBHm_Chr4g0396741 RchiOBHm_Chr5g0067921 RchiOBHm_Chr5g0070701 RchiOBHm_Chr6g0261841 RchiOBHm_Chr6g0284271 RchiOBHm_Chr7g0197681
rosa_laevigata	RLG00000009824
rosa_multiflora	Rmu_co7992122.1_g000001 Rmu_sc0000090.1_g000012 Rmu_sc0000452.1_g000030 Rmu_sc0000780.1_g000002 Rmu_sc0003767.1_g000027 Rmu_sc0004112.1_g000002 Rmu_sc0018143.1_g000001
rosa_roxburghii	Rroxscaffold_2G00097740 Rroxscaffold_2G00117160 Rroxscaffold_2G00121820 Rroxscaffold_2G00126180 Rroxscaffold_6G00389050 Rroxscaffold_6G00399500
rosa_rugosa	Rorug02G0415900 Rorug07G0127900
rosa_samantha	Rh1AG355400 Rh1BG259200 Rh1CG064300 Rh1DG289200 Rh2AG360400 Rh2AG475600 Rh2AG551100 Rh2AG551200 Rh2BG365200 Rh2BG487000 Rh2CG327000 Rh2CG461100 Rh2DG496100 Rh5BG166300 Rh5DG280300 Rh6DG270000 Rh6DG270100 Rh7AG438900 Rh7CG425500
rosa_wichuraiana	Rw0G013420 Rw1G003830 Rw1G031360 Rw2G019280 Rw2G038760 Rw5G047430 Rw6G006480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	272, 380
AcsI	RAATTY	1 cut(s)	378
AfaI	GTAC	1 cut(s)	9
AgsI	TTSAA	4 cut(s)	110, 146, 185, 399
AluBI	AGCT	3 cut(s)	155, 215, 323
AluI	AGCT	3 cut(s)	155, 215, 323
Alw26I	GTCTC	2 cut(s)	27, 249
AlwI	GGATC	2 cut(s)	272, 380
ApeKI	GCWGC	5 cut(s)	152, 233, 314, 338, 341
ApoI	RAATTY	1 cut(s)	378
AspLEI	GCGC	2 cut(s)	191, 314
AspS9I	GGNCC	1 cut(s)	227
AsuHPI	GGTGA	1 cut(s)	9
AvaII	GGWCC	1 cut(s)	227
BbvCI	CCTCAGC	1 cut(s)	237
BbvI	GCAGC	5 cut(s)	164, 220, 301, 325, 353
BccI	CCATC	1 cut(s)	302
BcoDI	GTCTC	2 cut(s)	27, 249
BfmI	CTRYAG	5 cut(s)	93, 156, 318, 339, 390
BfoI	RGCGCY	2 cut(s)	192, 315
BisI	GCNGC	5 cut(s)	153, 234, 315, 339, 342
BlsI	GCNGC	5 cut(s)	154, 235, 316, 340, 343
Bme18I	GGWCC	1 cut(s)	227
BmgT120I	GGNCC	1 cut(s)	227
BmsI	GCATC	1 cut(s)	353
Bpu10I	CCTNAGC	1 cut(s)	237
BsaJI	CCNNGG	2 cut(s)	20, 41
Bse3DI	GCAATG	1 cut(s)	483
BseDI	CCNNGG	2 cut(s)	20, 41
BseGI	GGATG	3 cut(s)	77, 313, 487
BseMI	GCAATG	1 cut(s)	483
BseMII	CTCAG	2 cut(s)	228, 294
BseXI	GCAGC	5 cut(s)	164, 220, 301, 325, 353
BsmAI	GTCTC	2 cut(s)	27, 249
Bsp143I	GATC	2 cut(s)	277, 385
Bsp19I	CCATGG	1 cut(s)	20
BspCNI	CTCAG	2 cut(s)	229, 295
BspHI	TCATGA	2 cut(s)	274, 297
BspMAI	CTGCAG	1 cut(s)	343
BspPI	GGATC	2 cut(s)	272, 380
BsrDI	GCAATG	1 cut(s)	483
BssECI	CCNNGG	2 cut(s)	20, 41
BssMI	GATC	2 cut(s)	277, 385
BssT1I	CCWWGG	2 cut(s)	20, 41
Bst6I	CTCTTC	1 cut(s)	201
BstDEI	CTNAG	2 cut(s)	237, 303
BstDSI	CCRYGG	1 cut(s)	20
BstF5I	GGATG	3 cut(s)	77, 313, 487
BstH2I	RGCGCY	2 cut(s)	192, 315
BstHHI	GCGC	2 cut(s)	191, 314
BstKTI	GATC	2 cut(s)	280, 388
BstMAI	GTCTC	2 cut(s)	27, 249
BstMBI	GATC	2 cut(s)	277, 385
BstMWI	GCNNNNNNNGC	4 cut(s)	212, 320, 329, 338
BstNSI	RCATGY	1 cut(s)	461
BstSFI	CTRYAG	5 cut(s)	93, 156, 318, 339, 390
BstV1I	GCAGC	5 cut(s)	164, 220, 301, 325, 353
BtgI	CCRYGG	1 cut(s)	20
BtsCI	GGATG	3 cut(s)	77, 313, 487
CciI	TCATGA	2 cut(s)	274, 297
CfoI	GCGC	2 cut(s)	191, 314
Cfr13I	GGNCC	1 cut(s)	227
Csp6I	GTAC	1 cut(s)	8
CspCI	CAANNNNNGTGG	2 cut(s)	98, 133
CviAII	CATG	6 cut(s)	21, 101, 244, 275, 298, 458
CviJI	RGCY	6 cut(s)	61, 155, 215, 323, 431, 502
CviKI_1	RGCY	6 cut(s)	61, 155, 215, 323, 431, 502
CviQI	GTAC	1 cut(s)	8
DdeI	CTNAG	2 cut(s)	237, 303
DpnI	GATC	2 cut(s)	279, 387
DpnII	GATC	2 cut(s)	277, 385
Eam1104I	CTCTTC	1 cut(s)	201
EarI	CTCTTC	1 cut(s)	201
Eco130I	CCWWGG	2 cut(s)	20, 41
Eco47I	GGWCC	1 cut(s)	227
EcoO109I	RGGNCCY	1 cut(s)	227
EcoT14I	CCWWGG	2 cut(s)	20, 41
ErhI	CCWWGG	2 cut(s)	20, 41
FaeI	CATG	6 cut(s)	24, 104, 247, 278, 301, 461
FatI	CATG	6 cut(s)	20, 100, 243, 274, 297, 457
Fnu4HI	GCNGC	5 cut(s)	153, 234, 315, 339, 342
FokI	GGATG	3 cut(s)	84, 320, 494
Fsp4HI	GCNGC	5 cut(s)	153, 234, 315, 339, 342
GlaI	GCGC	2 cut(s)	190, 313
GluI	GCNGC	5 cut(s)	153, 234, 315, 339, 342
HaeII	RGCGCY	2 cut(s)	192, 315
HhaI	GCGC	2 cut(s)	191, 314
Hin1II	CATG	6 cut(s)	24, 104, 247, 278, 301, 461
Hin6I	GCGC	2 cut(s)	189, 312
HinP1I	GCGC	2 cut(s)	189, 312
HinfI	GANTC	1 cut(s)	451
HphI	GGTGA	1 cut(s)	9
Hpy166II	GTNNAC	1 cut(s)	509
Hpy188I	TCNGA	1 cut(s)	441
Hpy188III	TCNNGA	3 cut(s)	220, 275, 298
Hpy8I	GTNNAC	1 cut(s)	509
HpyAV	CCTTC	2 cut(s)	179, 425
HpyCH4V	TGCA	6 cut(s)	4, 50, 89, 152, 293, 341
HpyF10VI	GCNNNNNNNGC	4 cut(s)	212, 320, 329, 338
HpyF3I	CTNAG	2 cut(s)	237, 303
Hsp92II	CATG	6 cut(s)	24, 104, 247, 278, 301, 461
HspAI	GCGC	2 cut(s)	189, 312
Kzo9I	GATC	2 cut(s)	277, 385
LpnPI	CCDG	4 cut(s)	69, 243, 309, 354
Lsp1109I	GCAGC	5 cut(s)	164, 220, 301, 325, 353
LweI	GCATC	1 cut(s)	353
MaeIII	GTNAC	2 cut(s)	15, 364
MalI	GATC	2 cut(s)	279, 387
MboI	GATC	2 cut(s)	277, 385
MboII	GAAGA	1 cut(s)	188
MfeI	CAATTG	1 cut(s)	399
MluCI	AATT	5 cut(s)	248, 378, 399, 465, 516
MnlI	CCTC	5 cut(s)	50, 144, 232, 295, 298
MseI	TTAA	3 cut(s)	251, 464, 526
MunI	CAATTG	1 cut(s)	399
MwoI	GCNNNNNNNGC	4 cut(s)	212, 320, 329, 338
NcoI	CCATGG	1 cut(s)	20
NdeII	GATC	2 cut(s)	277, 385
NlaIII	CATG	6 cut(s)	24, 104, 247, 278, 301, 461
NmuCI	GTSAC	2 cut(s)	15, 364
NspI	RCATGY	1 cut(s)	461
PagI	TCATGA	2 cut(s)	274, 297
PfeI	GAWTC	1 cut(s)	451
PkrI	GCNGC	5 cut(s)	154, 235, 316, 340, 343
PpuMI	RGGWCCY	1 cut(s)	227
Psp5II	RGGWCCY	1 cut(s)	227
PspPI	GGNCC	1 cut(s)	227
PspPPI	RGGWCCY	1 cut(s)	227
PstI	CTGCAG	1 cut(s)	343
RsaI	GTAC	1 cut(s)	9
RsaNI	GTAC	1 cut(s)	8
SaqAI	TTAA	3 cut(s)	251, 464, 526
SatI	GCNGC	5 cut(s)	153, 234, 315, 339, 342
Sau3AI	GATC	2 cut(s)	277, 385
Sau96I	GGNCC	1 cut(s)	227
SetI	ASST	9 cut(s)	47, 88, 157, 217, 229, 287, 325, 397, 417
SfaNI	GCATC	1 cut(s)	353
SfcI	CTRYAG	5 cut(s)	93, 156, 318, 339, 390
SinI	GGWCC	1 cut(s)	227
Sse9I	AATT	5 cut(s)	248, 378, 399, 465, 516
SspI	AATATT	1 cut(s)	142
StyI	CCWWGG	2 cut(s)	20, 41
TaqI	TCGA	2 cut(s)	55, 454
TasI	AATT	5 cut(s)	248, 378, 399, 465, 516
TatI	WGTACW	1 cut(s)	7
TfiI	GAWTC	1 cut(s)	451
Tru1I	TTAA	3 cut(s)	251, 464, 526
Tru9I	TTAA	3 cut(s)	251, 464, 526
TseFI	GTSAC	2 cut(s)	15, 364
TseI	GCWGC	5 cut(s)	152, 233, 314, 338, 341
Tsp45I	GTSAC	2 cut(s)	15, 364
TspDTI	ATGAA	2 cut(s)	89, 260
VpaK11BI	GGWCC	1 cut(s)	227
XapI	RAATTY	1 cut(s)	378
XceI	RCATGY	1 cut(s)	461

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.