Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0000942

Physical Location & Seq

Genomic Coordinates Reverse (-)

15555831 .. 15558112

Gene Structure 2282 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ17684

Sequence Viewer

CDS Protein Promoter (2k)

Length: 174 bp

ATGGCGTGGCATGATCCTACCTCTATTGCAGTCATGACTGAGGATGGTGCTGCTGTAGCTGGTCTTGCTATTGCTACAGCATCATTGGTTGCTGTAAATGTCACAGGAAATGGAATTTACGATCCTATAGGTTCATTTGTAGTTGGCAAGGACCTTGGAATGGTGGCTATCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cation_efflux

Protein Analysis

57

Amino Acids

5.66

Weight (kDa)

4.05

Isoelectric Point (pI)

13.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000942)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G51610
fragaria_vesca	FvH4_6g16400 FvH4_6g37160
malus_domestica	MD09G1160600.v1.1 MD17G1146400.v1.1
prunus_persica	Prupe.3G019200_v2.0.a1 Prupe.3G019200_v2.0.a1 Prupe.3G019200_v2.0.a1
pyrus_communis	pycom08g05510 pycom09g07920 pycom10g14680 pycom17g13910
rosa_chinensis	RchiOBHm_Chr1g0341791 RchiOBHm_Chr2g0132611 RchiOBHm_Chr2g0145001 RchiOBHm_Chr2g0149771 RchiOBHm_Chr4g0396741 RchiOBHm_Chr5g0067921 RchiOBHm_Chr5g0070701 RchiOBHm_Chr6g0261841 RchiOBHm_Chr6g0284271 RchiOBHm_Chr7g0197681
rosa_laevigata	RLG00000009824
rosa_multiflora	Rmu_co7992122.1_g000001 Rmu_sc0000090.1_g000012 Rmu_sc0000452.1_g000030 Rmu_sc0000780.1_g000002 Rmu_sc0003767.1_g000027 Rmu_sc0004112.1_g000002 Rmu_sc0018143.1_g000001
rosa_roxburghii	Rroxscaffold_2G00097740 Rroxscaffold_2G00117160 Rroxscaffold_2G00121820 Rroxscaffold_2G00126180 Rroxscaffold_6G00389050 Rroxscaffold_6G00399500
rosa_rugosa	Rorug02G0415900 Rorug07G0127900
rosa_samantha	Rh1AG355400 Rh1BG259200 Rh1CG064300 Rh1DG289200 Rh2AG360400 Rh2AG475600 Rh2AG551100 Rh2AG551200 Rh2BG365200 Rh2BG487000 Rh2CG327000 Rh2CG461100 Rh2DG496100 Rh5BG166300 Rh5DG280300 Rh6DG270000 Rh6DG270100 Rh7AG438900 Rh7CG425500
rosa_wichuraiana	Rw0G013420 Rw1G003830 Rw1G031360 Rw2G019280 Rw2G038760 Rw5G047430 Rw6G006480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	8, 116
AcsI	RAATTY	1 cut(s)	114
AfiI	CCNNNNNNNGG	1 cut(s)	160
AluBI	AGCT	1 cut(s)	59
AluI	AGCT	1 cut(s)	59
AlwI	GGATC	2 cut(s)	8, 116
ApeKI	GCWGC	1 cut(s)	50
ApoI	RAATTY	1 cut(s)	114
AspS9I	GGNCC	1 cut(s)	151
AvaII	GGWCC	1 cut(s)	151
BbvI	GCAGC	1 cut(s)	37
BccI	CCATC	1 cut(s)	38
BfmI	CTRYAG	3 cut(s)	54, 75, 126
BisI	GCNGC	1 cut(s)	51
BlsI	GCNGC	1 cut(s)	52
Bme18I	GGWCC	1 cut(s)	151
BmgT120I	GGNCC	1 cut(s)	151
BmsI	GCATC	1 cut(s)	89
BsaJI	CCNNGG	1 cut(s)	154
Bsc4I	CCNNNNNNNGG	1 cut(s)	160
BseDI	CCNNGG	1 cut(s)	154
BseGI	GGATG	1 cut(s)	49
BseLI	CCNNNNNNNGG	1 cut(s)	160
BseMII	CTCAG	1 cut(s)	30
BseXI	GCAGC	1 cut(s)	37
BslI	CCNNNNNNNGG	1 cut(s)	160
Bsp143I	GATC	2 cut(s)	13, 121
BspCNI	CTCAG	1 cut(s)	31
BspHI	TCATGA	1 cut(s)	33
BspPI	GGATC	2 cut(s)	8, 116
BssECI	CCNNGG	1 cut(s)	154
BssMI	GATC	2 cut(s)	13, 121
BssT1I	CCWWGG	1 cut(s)	154
BstDEI	CTNAG	1 cut(s)	39
BstF5I	GGATG	1 cut(s)	49
BstKTI	GATC	2 cut(s)	16, 124
BstMBI	GATC	2 cut(s)	13, 121
BstMWI	GCNNNNNNNGC	2 cut(s)	56, 65
BstSFI	CTRYAG	3 cut(s)	54, 75, 126
BstV1I	GCAGC	1 cut(s)	37
BtsCI	GGATG	1 cut(s)	49
CciI	TCATGA	1 cut(s)	33
Cfr13I	GGNCC	1 cut(s)	151
CviAII	CATG	2 cut(s)	11, 34
CviJI	RGCY	2 cut(s)	59, 167
CviKI_1	RGCY	2 cut(s)	59, 167
DdeI	CTNAG	1 cut(s)	39
DpnI	GATC	2 cut(s)	15, 123
DpnII	GATC	2 cut(s)	13, 121
Eco130I	CCWWGG	1 cut(s)	154
Eco47I	GGWCC	1 cut(s)	151
EcoO109I	RGGNCCY	1 cut(s)	151
EcoT14I	CCWWGG	1 cut(s)	154
ErhI	CCWWGG	1 cut(s)	154
FaeI	CATG	2 cut(s)	14, 37
FaiI	YATR	3 cut(s)	12, 35, 128
FatI	CATG	2 cut(s)	10, 33
Fnu4HI	GCNGC	1 cut(s)	51
FokI	GGATG	1 cut(s)	56
Fsp4HI	GCNGC	1 cut(s)	51
GluI	GCNGC	1 cut(s)	51
Hin1II	CATG	2 cut(s)	14, 37
Hpy188I	TCNGA	1 cut(s)	173
Hpy188III	TCNNGA	1 cut(s)	34
HpyCH4V	TGCA	1 cut(s)	29
HpyF10VI	GCNNNNNNNGC	2 cut(s)	56, 65
HpyF3I	CTNAG	1 cut(s)	39
Hsp92II	CATG	2 cut(s)	14, 37
Kzo9I	GATC	2 cut(s)	13, 121
LpnPI	CCDG	2 cut(s)	45, 90
Lsp1109I	GCAGC	1 cut(s)	37
LweI	GCATC	1 cut(s)	89
MaeIII	GTNAC	1 cut(s)	100
MalI	GATC	2 cut(s)	15, 123
MboI	GATC	2 cut(s)	13, 121
MluCI	AATT	1 cut(s)	114
MnlI	CCTC	2 cut(s)	31, 34
MwoI	GCNNNNNNNGC	2 cut(s)	56, 65
NdeII	GATC	2 cut(s)	13, 121
NlaIII	CATG	2 cut(s)	14, 37
NmuCI	GTSAC	1 cut(s)	100
PagI	TCATGA	1 cut(s)	33
PkrI	GCNGC	1 cut(s)	52
PpuMI	RGGWCCY	1 cut(s)	151
Psp5II	RGGWCCY	1 cut(s)	151
PspPI	GGNCC	1 cut(s)	151
PspPPI	RGGWCCY	1 cut(s)	151
SatI	GCNGC	1 cut(s)	51
Sau3AI	GATC	2 cut(s)	13, 121
Sau96I	GGNCC	1 cut(s)	151
SetI	ASST	4 cut(s)	23, 61, 133, 156
SfaNI	GCATC	1 cut(s)	89
SfcI	CTRYAG	3 cut(s)	54, 75, 126
SgeI	CNNG	8 cut(s)	18, 23, 46, 72, 77, 117, 160, 167
SinI	GGWCC	1 cut(s)	151
Sse9I	AATT	1 cut(s)	114
StyI	CCWWGG	1 cut(s)	154
TasI	AATT	1 cut(s)	114
TseFI	GTSAC	1 cut(s)	100
TseI	GCWGC	1 cut(s)	50
Tsp45I	GTSAC	1 cut(s)	100
TspDTI	ATGAA	1 cut(s)	123
VpaK11BI	GGWCC	1 cut(s)	151
XapI	RAATTY	1 cut(s)	114

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.