RchiOBHm_Chr4g0396741

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0000942
Physical Location & Seq
Forward (+)
12822123 .. 12823216
1094 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36911

Sequence Viewer

Length: 201 bp
ATGGAGTACTCTCACTCTCTCCCCGAGTTCAAATCGATTTTGATTCCACCTTCCAGAGTTCCAGGCTCTAGCCACCGAGCCACCTCCCTATTCAGAGTTTCAGTCCGCCTGATCTACCTCTTCCACCACCGTCCACCGAGCCACCTCCATTGTAGTCTGCATCTCTGGATTCTCTGCGACAGTGCGACTCCTGCTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.52

Weight (kDa)

9.38

Isoelectric Point (pI)

54.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 106
AfaI GTAC 1 cut(s) 8
AgsI TTSAA 1 cut(s) 31
AjnI CCWGG 1 cut(s) 61
Ama87I CYCGRG 1 cut(s) 23
AvaI CYCGRG 1 cut(s) 23
BciT130I CCWGG 1 cut(s) 63
BfaI CTAG 1 cut(s) 69
BmcAI AGTACT 1 cut(s) 8
Bme1390I CCNGG 1 cut(s) 63
BmeT110I CYCGRG 1 cut(s) 23
BmrFI CCNGG 1 cut(s) 63
BmsI GCATC 1 cut(s) 169
Bsa29I ATCGAT 1 cut(s) 35
BseBI CCWGG 1 cut(s) 63
BseCI ATCGAT 1 cut(s) 35
BshVI ATCGAT 1 cut(s) 35
BsiHKCI CYCGRG 1 cut(s) 23
BsoBI CYCGRG 1 cut(s) 23
Bsp143I GATC 1 cut(s) 111
BspACI CCGC 1 cut(s) 106
BspDI ATCGAT 1 cut(s) 35
BssMI GATC 1 cut(s) 111
Bst2UI CCWGG 1 cut(s) 63
Bst4CI ACNGT 2 cut(s) 131, 182
Bst6I CTCTTC 1 cut(s) 125
BstKTI GATC 1 cut(s) 114
BstMBI GATC 1 cut(s) 111
BstMWI GCNNNNNNNGC 1 cut(s) 191
BstNI CCWGG 1 cut(s) 63
BstSCI CCNGG 1 cut(s) 61
Bsu15I ATCGAT 1 cut(s) 35
BsuTUI ATCGAT 1 cut(s) 35
BtsIMutI CAGTG 1 cut(s) 187
ClaI ATCGAT 1 cut(s) 35
Csp6I GTAC 1 cut(s) 7
CspCI CAANNNNNGTGG 2 cut(s) 131, 166
CviJI RGCY 4 cut(s) 66, 72, 80, 141
CviKI_1 RGCY 4 cut(s) 66, 72, 80, 141
CviQI GTAC 1 cut(s) 7
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
Eam1104I CTCTTC 1 cut(s) 125
EarI CTCTTC 1 cut(s) 125
EciI GGCGGA 1 cut(s) 95
Eco88I CYCGRG 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 61
FspBI CTAG 1 cut(s) 69
HinfI GANTC 3 cut(s) 43, 169, 187
Hpy166II GTNNAC 1 cut(s) 134
Hpy188I TCNGA 1 cut(s) 95
Hpy188III TCNNGA 3 cut(s) 54, 166, 198
Hpy8I GTNNAC 1 cut(s) 134
HpyAV CCTTC 1 cut(s) 60
HpyCH4III ACNGT 2 cut(s) 131, 182
HpyCH4V TGCA 1 cut(s) 160
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
Kzo9I GATC 1 cut(s) 111
LpnPI CCDG 5 cut(s) 48, 67, 75, 122, 151
LweI GCATC 1 cut(s) 169
MaeI CTAG 1 cut(s) 69
MalI GATC 1 cut(s) 113
MboI GATC 1 cut(s) 111
MboII GAAGA 1 cut(s) 112
MlyI GAGTC 1 cut(s) 181
MnlI CCTC 3 cut(s) 94, 128, 155
MspR9I CCNGG 1 cut(s) 63
MvaI CCWGG 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 191
NdeII GATC 1 cut(s) 111
PfeI GAWTC 2 cut(s) 43, 169
PleI GAGTC 1 cut(s) 181
PpsI GAGTC 1 cut(s) 181
Psp6I CCWGG 1 cut(s) 61
PspGI CCWGG 1 cut(s) 61
RsaI GTAC 1 cut(s) 8
RsaNI GTAC 1 cut(s) 7
Sau3AI GATC 1 cut(s) 111
ScaI AGTACT 1 cut(s) 8
SchI GAGTC 1 cut(s) 181
ScrFI CCNGG 1 cut(s) 63
SetI ASST 4 cut(s) 52, 86, 120, 147
SfaNI GCATC 1 cut(s) 169
SsiI CCGC 1 cut(s) 106
SspMI CTAG 1 cut(s) 69
StyD4I CCNGG 1 cut(s) 61
TaaI ACNGT 2 cut(s) 131, 182
TaqI TCGA 1 cut(s) 35
TatI WGTACW 1 cut(s) 6
TfiI GAWTC 2 cut(s) 43, 169
TscAI CASTG 1 cut(s) 187
TspRI CASTG 1 cut(s) 187
XspI CTAG 1 cut(s) 69
ZrmI AGTACT 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.