Rh1CG064300

Metal tolerance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0000942
Physical Location & Seq
Forward (+)
12822708 .. 12835412
12705 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG064300.1

Sequence Viewer

Length: 306 bp
ATGGCATCCTTTCCATTTTCCAATCTTAATCTTGGTGTGGATGAGAGCTATACTCTATTTGTATTGAAGAAAGATGGGAAAGCTATTGTTGGGGAGGCCACGATTGAGGCAAACATGGTGGATGGCGCTTCTCTTCTTGTTGCCATACAAGCTGTCAAGAAAGGTGCTGCTGCAGAGGGCATGAAATTAAGAGACTATATATGGCGTGGTCATGATCTTACCTCTGTTGCAGTCATGACTGAGGATGGCGCTGCTGTAGCTGGTCTTGCTATTGCTGCAACATCATTGGTTGTTGTTCATTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cation_efflux

Protein Analysis

101

Amino Acids

10.51

Weight (kDa)

5.16

Isoelectric Point (pI)

13.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 67
AluBI AGCT 4 cut(s) 48, 83, 152, 260
AluI AGCT 4 cut(s) 48, 83, 152, 260
Alw26I GTCTC 1 cut(s) 186
AoxI GGCC 1 cut(s) 96
ApeKI GCWGC 4 cut(s) 167, 170, 251, 275
AspLEI GCGC 2 cut(s) 128, 251
BbvI GCAGC 4 cut(s) 154, 157, 238, 262
BccI CCATC 3 cut(s) 68, 116, 239
BcoDI GTCTC 1 cut(s) 186
BfmI CTRYAG 2 cut(s) 171, 255
BfoI RGCGCY 2 cut(s) 129, 252
BisI GCNGC 4 cut(s) 168, 171, 252, 276
BlsI GCNGC 4 cut(s) 169, 172, 253, 277
BmsI GCATC 1 cut(s) 14
BplI GAGNNNNNCTC 2 cut(s) 37, 69
BseGI GGATG 4 cut(s) 5, 46, 127, 250
BseMII CTCAG 1 cut(s) 231
BseXI GCAGC 4 cut(s) 154, 157, 238, 262
BshFI GGCC 1 cut(s) 98
BsmAI GTCTC 1 cut(s) 186
BsnI GGCC 1 cut(s) 98
Bsp143I GATC 1 cut(s) 214
BspANI GGCC 1 cut(s) 98
BspCNI CTCAG 1 cut(s) 232
BspHI TCATGA 2 cut(s) 211, 234
BspMAI CTGCAG 1 cut(s) 175
BssMI GATC 1 cut(s) 214
Bst6I CTCTTC 1 cut(s) 138
BstDEI CTNAG 1 cut(s) 240
BstF5I GGATG 4 cut(s) 5, 46, 127, 250
BstH2I RGCGCY 2 cut(s) 129, 252
BstHHI GCGC 2 cut(s) 128, 251
BstKTI GATC 1 cut(s) 217
BstMAI GTCTC 1 cut(s) 186
BstMBI GATC 1 cut(s) 214
BstMWI GCNNNNNNNGC 4 cut(s) 149, 257, 266, 275
BstSFI CTRYAG 2 cut(s) 171, 255
BstV1I GCAGC 4 cut(s) 154, 157, 238, 262
BsuRI GGCC 1 cut(s) 98
BtsCI GGATG 4 cut(s) 5, 46, 127, 250
CciI TCATGA 2 cut(s) 211, 234
CfoI GCGC 2 cut(s) 128, 251
CspCI CAANNNNNGTGG 2 cut(s) 99, 134
CviAII CATG 4 cut(s) 115, 181, 212, 235
CviJI RGCY 5 cut(s) 48, 83, 98, 152, 260
CviKI_1 RGCY 5 cut(s) 48, 83, 98, 152, 260
DdeI CTNAG 1 cut(s) 240
DpnI GATC 1 cut(s) 216
DpnII GATC 1 cut(s) 214
Eam1104I CTCTTC 1 cut(s) 138
EarI CTCTTC 1 cut(s) 138
FaeI CATG 4 cut(s) 118, 184, 215, 238
FaiI YATR 9 cut(s) 51, 116, 146, 182, 198, 200, 202, 213, 236
FatI CATG 4 cut(s) 114, 180, 211, 234
Fnu4HI GCNGC 4 cut(s) 168, 171, 252, 276
FokI GGATG 3 cut(s) 53, 134, 257
Fsp4HI GCNGC 4 cut(s) 168, 171, 252, 276
GlaI GCGC 2 cut(s) 127, 250
GluI GCNGC 4 cut(s) 168, 171, 252, 276
HaeII RGCGCY 2 cut(s) 129, 252
HaeIII GGCC 1 cut(s) 98
HhaI GCGC 2 cut(s) 128, 251
Hin1II CATG 4 cut(s) 118, 184, 215, 238
Hin6I GCGC 2 cut(s) 126, 249
HinP1I GCGC 2 cut(s) 126, 249
Hpy188III TCNNGA 3 cut(s) 157, 212, 235
HpyCH4V TGCA 3 cut(s) 173, 230, 278
HpyF10VI GCNNNNNNNGC 4 cut(s) 149, 257, 266, 275
HpyF3I CTNAG 1 cut(s) 240
Hsp92II CATG 4 cut(s) 118, 184, 215, 238
HspAI GCGC 2 cut(s) 126, 249
Kzo9I GATC 1 cut(s) 214
LpnPI CCDG 1 cut(s) 246
Lsp1109I GCAGC 4 cut(s) 154, 157, 238, 262
LweI GCATC 1 cut(s) 14
MalI GATC 1 cut(s) 216
MboI GATC 1 cut(s) 214
MboII GAAGA 2 cut(s) 79, 125
MluCI AATT 1 cut(s) 185
MnlI CCTC 5 cut(s) 88, 100, 169, 232, 235
MseI TTAA 2 cut(s) 27, 188
MwoI GCNNNNNNNGC 4 cut(s) 149, 257, 266, 275
NdeII GATC 1 cut(s) 214
NlaIII CATG 4 cut(s) 118, 184, 215, 238
PagI TCATGA 2 cut(s) 211, 234
PkrI GCNGC 4 cut(s) 169, 172, 253, 277
PstI CTGCAG 1 cut(s) 175
SaqAI TTAA 2 cut(s) 27, 188
SatI GCNGC 4 cut(s) 168, 171, 252, 276
Sau3AI GATC 1 cut(s) 214
SetI ASST 6 cut(s) 50, 85, 154, 166, 224, 262
SfaNI GCATC 1 cut(s) 14
SfcI CTRYAG 2 cut(s) 171, 255
Sse9I AATT 1 cut(s) 185
TasI AATT 1 cut(s) 185
Tru1I TTAA 2 cut(s) 27, 188
Tru9I TTAA 2 cut(s) 27, 188
TseI GCWGC 4 cut(s) 167, 170, 251, 275
TspDTI ATGAA 2 cut(s) 197, 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.