RLG00000009824

Metal tolerance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
OG0000942
Physical Location & Seq
Reverse (-)
58516744 .. 58518650
1907 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000009824

Sequence Viewer

Length: 387 bp
ATGAGTTGTGGTGCACTTAATCTTGGTGTGGATGAGAGCTATACTCTATTTGTATTGAAGAAAGATGGGAAAGCTATTGTTGGGGAGGCCACCATTGAGGCAAAACACAGTGTATGGTGCGTTGTGGGGGTTAGAGGCGCTTCTCTGCTTGTTGCCATACAAGCTATCAAGAAAGGTGCTGCTGCTGAGGGCATGAAATTAAGAGACTATATATGGCGTGGTCATGATCCTACCTCTGTTGCAATCATGACTGAGGATGGCGCTGCTGTAGCTGGTCTTGCTATTGCTGCAGCATCATTGGTTGATGTAAATGTCACAGGAAATGGAATTTACGATCCTATAGGTTCAATTGTAGTTGGCAAGGATCTTGGAATGGTGGCTATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cation_efflux

Protein Analysis

129

Amino Acids

13.1

Weight (kDa)

5.57

Isoelectric Point (pI)

7.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 221, 329, 372
AcsI RAATTY 1 cut(s) 327
AgsI TTSAA 2 cut(s) 58, 348
AluBI AGCT 4 cut(s) 39, 74, 164, 272
AluI AGCT 4 cut(s) 39, 74, 164, 272
Alw21I GWGCWC 1 cut(s) 16
Alw26I GTCTC 1 cut(s) 198
Alw44I GTGCAC 1 cut(s) 12
AlwI GGATC 3 cut(s) 221, 329, 372
AoxI GGCC 1 cut(s) 87
ApaLI GTGCAC 1 cut(s) 12
ApeKI GCWGC 5 cut(s) 179, 182, 263, 287, 290
ApoI RAATTY 1 cut(s) 327
AspLEI GCGC 2 cut(s) 140, 263
BaeGI GKGCMC 1 cut(s) 16
Bbv12I GWGCWC 1 cut(s) 16
BbvCI CCTCAGC 1 cut(s) 186
BbvI GCAGC 5 cut(s) 166, 169, 250, 274, 302
BccI CCATC 2 cut(s) 59, 251
BcoDI GTCTC 1 cut(s) 198
BfmI CTRYAG 3 cut(s) 267, 288, 339
BfoI RGCGCY 2 cut(s) 141, 264
BisI GCNGC 5 cut(s) 180, 183, 264, 288, 291
BlsI GCNGC 5 cut(s) 181, 184, 265, 289, 292
BmsI GCATC 1 cut(s) 302
BplI GAGNNNNNCTC 2 cut(s) 28, 60
Bpu10I CCTNAGC 1 cut(s) 186
BseGI GGATG 2 cut(s) 37, 262
BseMII CTCAG 2 cut(s) 177, 243
BseSI GKGCMC 1 cut(s) 16
BseXI GCAGC 5 cut(s) 166, 169, 250, 274, 302
BshFI GGCC 1 cut(s) 89
BsiHKAI GWGCWC 1 cut(s) 16
BsmAI GTCTC 1 cut(s) 198
BsnI GGCC 1 cut(s) 89
Bsp1286I GDGCHC 1 cut(s) 16
Bsp143I GATC 3 cut(s) 226, 334, 364
BspANI GGCC 1 cut(s) 89
BspCNI CTCAG 2 cut(s) 178, 244
BspHI TCATGA 2 cut(s) 223, 246
BspMAI CTGCAG 1 cut(s) 292
BspPI GGATC 3 cut(s) 221, 329, 372
BssMI GATC 3 cut(s) 226, 334, 364
Bst4CI ACNGT 1 cut(s) 110
BstDEI CTNAG 2 cut(s) 186, 252
BstF5I GGATG 2 cut(s) 37, 262
BstH2I RGCGCY 2 cut(s) 141, 264
BstHHI GCGC 2 cut(s) 140, 263
BstKTI GATC 3 cut(s) 229, 337, 367
BstMAI GTCTC 1 cut(s) 198
BstMBI GATC 3 cut(s) 226, 334, 364
BstMWI GCNNNNNNNGC 4 cut(s) 161, 269, 278, 287
BstSFI CTRYAG 3 cut(s) 267, 288, 339
BstSLI GKGCMC 1 cut(s) 16
BstV1I GCAGC 5 cut(s) 166, 169, 250, 274, 302
BstX2I RGATCY 1 cut(s) 364
BstYI RGATCY 1 cut(s) 364
BsuRI GGCC 1 cut(s) 89
BtsCI GGATG 2 cut(s) 37, 262
BtsIMutI CAGTG 1 cut(s) 115
CciI TCATGA 2 cut(s) 223, 246
CfoI GCGC 2 cut(s) 140, 263
CviAII CATG 3 cut(s) 193, 224, 247
CviJI RGCY 6 cut(s) 39, 74, 89, 164, 272, 380
CviKI_1 RGCY 6 cut(s) 39, 74, 89, 164, 272, 380
DdeI CTNAG 2 cut(s) 186, 252
DpnI GATC 3 cut(s) 228, 336, 366
DpnII GATC 3 cut(s) 226, 334, 364
FaeI CATG 3 cut(s) 196, 227, 250
FatI CATG 3 cut(s) 192, 223, 246
Fnu4HI GCNGC 5 cut(s) 180, 183, 264, 288, 291
FokI GGATG 2 cut(s) 44, 269
Fsp4HI GCNGC 5 cut(s) 180, 183, 264, 288, 291
GlaI GCGC 2 cut(s) 139, 262
GluI GCNGC 5 cut(s) 180, 183, 264, 288, 291
HaeII RGCGCY 2 cut(s) 141, 264
HaeIII GGCC 1 cut(s) 89
HhaI GCGC 2 cut(s) 140, 263
Hin1II CATG 3 cut(s) 196, 227, 250
Hin6I GCGC 2 cut(s) 138, 261
HinP1I GCGC 2 cut(s) 138, 261
Hpy166II GTNNAC 1 cut(s) 14
Hpy188I TCNGA 1 cut(s) 386
Hpy188III TCNNGA 3 cut(s) 169, 224, 247
Hpy8I GTNNAC 1 cut(s) 14
HpyCH4III ACNGT 1 cut(s) 110
HpyCH4V TGCA 3 cut(s) 14, 242, 290
HpyF10VI GCNNNNNNNGC 4 cut(s) 161, 269, 278, 287
HpyF3I CTNAG 2 cut(s) 186, 252
Hsp92II CATG 3 cut(s) 196, 227, 250
HspAI GCGC 2 cut(s) 138, 261
Kzo9I GATC 3 cut(s) 226, 334, 364
LpnPI CCDG 2 cut(s) 258, 303
Lsp1109I GCAGC 5 cut(s) 166, 169, 250, 274, 302
LweI GCATC 1 cut(s) 302
MaeIII GTNAC 1 cut(s) 313
MalI GATC 3 cut(s) 228, 336, 366
MboI GATC 3 cut(s) 226, 334, 364
MboII GAAGA 1 cut(s) 70
MfeI CAATTG 1 cut(s) 348
MflI RGATCY 1 cut(s) 364
MhlI GDGCHC 1 cut(s) 16
MluCI AATT 3 cut(s) 197, 327, 348
MnlI CCTC 6 cut(s) 79, 91, 128, 181, 244, 247
MseI TTAA 2 cut(s) 18, 200
MunI CAATTG 1 cut(s) 348
MwoI GCNNNNNNNGC 4 cut(s) 161, 269, 278, 287
NdeII GATC 3 cut(s) 226, 334, 364
NlaIII CATG 3 cut(s) 196, 227, 250
NmuCI GTSAC 1 cut(s) 313
PagI TCATGA 2 cut(s) 223, 246
PkrI GCNGC 5 cut(s) 181, 184, 265, 289, 292
PstI CTGCAG 1 cut(s) 292
PsuI RGATCY 1 cut(s) 364
SaqAI TTAA 2 cut(s) 18, 200
SatI GCNGC 5 cut(s) 180, 183, 264, 288, 291
Sau3AI GATC 3 cut(s) 226, 334, 364
SduI GDGCHC 1 cut(s) 16
SetI ASST 7 cut(s) 41, 76, 166, 178, 236, 274, 346
SfaNI GCATC 1 cut(s) 302
SfcI CTRYAG 3 cut(s) 267, 288, 339
Sse9I AATT 3 cut(s) 197, 327, 348
TaaI ACNGT 1 cut(s) 110
TasI AATT 3 cut(s) 197, 327, 348
Tru1I TTAA 2 cut(s) 18, 200
Tru9I TTAA 2 cut(s) 18, 200
TscAI CASTG 1 cut(s) 115
TseFI GTSAC 1 cut(s) 313
TseI GCWGC 5 cut(s) 179, 182, 263, 287, 290
Tsp45I GTSAC 1 cut(s) 313
TspDTI ATGAA 1 cut(s) 209
TspRI CASTG 1 cut(s) 115
VneI GTGCAC 1 cut(s) 12
XapI RAATTY 1 cut(s) 327
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.